View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8820_low_24 (Length: 217)
Name: NF8820_low_24
Description: NF8820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8820_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 2817875 - 2817674
Alignment:
| Q |
13 |
ttagtaacggttccctttatttatgcaacgagtttgattgcatctcctttcacttcggtatagtcggataacaacctccatagtactgact--------t |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2817875 |
ttagtaacggttccctttatttatgcaacgagtttgattgcatctcctttcacttcggtatagtcggataacaacctccatagtactgactttccctact |
2817776 |
T |
|
| Q |
105 |
ctgaggtctgaaaagatagaaggaatatctaacctaannnnnnnatccattaccatcaacacagaatcatcccacaagtctctctatcccttcactactt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817775 |
ctgaggtctgaaaagatagaaggaatatctaacctaa-tttttgatccattaccatcaacacagaatcatcccacaagtctctctatcccttcactactt |
2817677 |
T |
|
| Q |
205 |
ctt |
207 |
Q |
| |
|
||| |
|
|
| T |
2817676 |
ctt |
2817674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University