View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8821_low_10 (Length: 310)
Name: NF8821_low_10
Description: NF8821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8821_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 40452165 - 40451873
Alignment:
| Q |
18 |
gcacaaactgtgagtggcccaatcttctcccttgtttgtgaattattttcttttctgaattatttatgtctctctctttgatcttacatatatttcaaac |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40452165 |
gcacaaactgtgagtggtccaatcttctcccttgtttgtgaattattttcttttctgaatgatttatgtctctctctttgatcttacatatatttcaaac |
40452066 |
T |
 |
| Q |
118 |
aatgtttcatgttcaggttgtcgttcagaaaaatagtcctagaggagttcattttcgccgtgctggacctcgagaaaaggtataaaacatggaaaattca |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40452065 |
aatgtttcatgttcagattgtcgttcagaaaaatagtcctagaggagttcattttcgccgtgctggacctcgagaaaaggtataaaacatggaaaattca |
40451966 |
T |
 |
| Q |
218 |
gtgttcatttgcaatgtttagaagctgacgataatgccttctaatcttaggtttacttcaaggcagaagaagtacgtgcttgcatagtgactt |
310 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451965 |
gtgttcatttgtaatgtttagaagctgacgataatgccttctaatattaggtttacttcaaggcagaagaagtacgtgcttgcatagtgactt |
40451873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University