View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8821_low_16 (Length: 235)

Name: NF8821_low_16
Description: NF8821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8821_low_16
NF8821_low_16
[»] chr5 (1 HSPs)
chr5 (12-222)||(24633658-24633868)
[»] chr1 (1 HSPs)
chr1 (12-222)||(52496887-52497097)


Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 24633658 - 24633868
Alignment:
12 atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24633658 atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta 24633757  T
112 gtgagataatggctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt 211  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24633758 gtgagataatggctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt 24633857  T
212 aactgctgatg 222  Q
    |||||||||||    
24633858 aactgctgatg 24633868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 52497097 - 52496887
Alignment:
12 atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52497097 atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta 52496998  T
112 gtgagataatggctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt 211  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52496997 gtgagataatggctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt 52496898  T
212 aactgctgatg 222  Q
    |||||||||||    
52496897 aactgctgatg 52496887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University