View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8822_low_3 (Length: 250)
Name: NF8822_low_3
Description: NF8822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8822_low_3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 13010336 - 13010578
Alignment:
| Q |
8 |
gaagcagagaagataatcagattgaatgaaacattagtagttacttgttttccatgaaacatttgcagagacattttgatgacaacatctcttatgtgtt |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
13010336 |
gaagcatagaagataatcagattgaatgaaacattagtagttacttgttttccatgaaacatttgcagagacattttgataacaacatctctgatgtgtt |
13010435 |
T |
 |
| Q |
108 |
aattagcttggaaaggtcatctccaataccatataaaataacatcactagagcttagcaatatttaaccaagacacacagaaaaacaatgacaaataggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13010436 |
aattagcttggaaaggtcatctccaataccatataaaataacatcactagatcttaacaatatttaaccaagacacacagaaaaacaatgacaaataggt |
13010535 |
T |
 |
| Q |
208 |
tcaaggaaacattctatatcacagatcattcagagcaacttct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13010536 |
tcaaggaaacattctatatcacagatcattcagagcaacttct |
13010578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 208
Target Start/End: Original strand, 13161253 - 13161286
Alignment:
| Q |
175 |
ccaagacacacagaaaaacaatgacaaataggtt |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
13161253 |
ccaagacacacagaacaacaatgacaaataggtt |
13161286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University