View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8822_low_5 (Length: 213)
Name: NF8822_low_5
Description: NF8822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8822_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 56468907 - 56468728
Alignment:
| Q |
18 |
attacaatcttgaataaacatatccatgtatttaagtatacattggctgactttgcaatcattaattacaattatccttgtttgttggctgggagtgagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56468907 |
attacaatcttgaataaacatatccatgcatttaagtatacattggctgactttgcaatcattaattacaattatccttgtatgttggctgggagtgagt |
56468808 |
T |
|
| Q |
118 |
attaactaacaattactaatatttgtggttgttatgcagagacctccaattgtgggaatcttgacaaggcacgacttcat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56468807 |
attaactaacaattactaatatttgtggttgttatgcagagacctccaattgtggggatcttgacaaggcacgacttcat |
56468728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University