View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8823_low_8 (Length: 251)
Name: NF8823_low_8
Description: NF8823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8823_low_8 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 12818810 - 12818710
Alignment:
| Q |
151 |
atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa |
250 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12818810 |
atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa |
12818711 |
T |
 |
| Q |
251 |
c |
251 |
Q |
| |
|
| |
|
|
| T |
12818710 |
c |
12818710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 40
Target Start/End: Complemental strand, 12818950 - 12818921
Alignment:
| Q |
11 |
cagagagagaaagagaaagagcgcgatgtc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12818950 |
cagagagagaaagagaaagagcgcgatgtc |
12818921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University