View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8823_low_8 (Length: 251)

Name: NF8823_low_8
Description: NF8823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8823_low_8
NF8823_low_8
[»] chr5 (2 HSPs)
chr5 (151-251)||(12818710-12818810)
chr5 (11-40)||(12818921-12818950)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 151 - 251
Target Start/End: Complemental strand, 12818810 - 12818710
Alignment:
151 atcacttcaaaaccctaatttattaaaaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttctccgaaa 250  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12818810 atcacttcaaaaccctaatttattataaccaaccaagaatttcacttcacttcttggaaatcctaaacttctctttctctcaattatttcttcttcgaaa 12818711  T
251 c 251  Q
    |    
12818710 c 12818710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 40
Target Start/End: Complemental strand, 12818950 - 12818921
Alignment:
11 cagagagagaaagagaaagagcgcgatgtc 40  Q
    ||||||||||||||||||||||||||||||    
12818950 cagagagagaaagagaaagagcgcgatgtc 12818921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University