View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8824_high_11 (Length: 239)
Name: NF8824_high_11
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8824_high_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 113 - 239
Target Start/End: Complemental strand, 3445884 - 3445758
Alignment:
| Q |
113 |
ggggggattcagatccacctcacctggctaatgtgaaaatatttaatattgcttgagttggaaaaaggtgtcaacaagtcactaatcctaatcttaatct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445884 |
ggggggattcagatccacctcacctggctaatgtgaaaatatttaatattgcttgagttggaaaaaggtgtcaacaagtcactaatcctaatcttaatct |
3445785 |
T |
|
| Q |
213 |
aatcctaatctttttatctaaacaatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3445784 |
aatcctaatctttttatctaaacaatt |
3445758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University