View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8824_high_12 (Length: 232)

Name: NF8824_high_12
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8824_high_12
NF8824_high_12
[»] chr2 (3 HSPs)
chr2 (1-231)||(12861369-12861599)
chr2 (1-128)||(12843882-12844009)
chr2 (133-232)||(12844050-12844149)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 12861599 - 12861369
Alignment:
1 cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12861599 cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat 12861500  T
101 tgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
12861499 tgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtggcgg 12861400  T
201 taacggtgacttcgaagttgatttggctttc 231  Q
    |||||||||||||||||||||||||||||||    
12861399 taacggtgacttcgaagttgatttggctttc 12861369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 12843882 - 12844009
Alignment:
1 cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat 100  Q
    |||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |  |||||||    
12843882 cggaatcatatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccat 12843981  T
101 tgaacgccgaggccgacaacaagattac 128  Q
    |||||||| ||||||||||  |||||||    
12843982 tgaacgccaaggccgacaatgagattac 12844009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 12844050 - 12844149
Alignment:
133 gcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca 232  Q
    ||||||| ||||||  ||||||| ||||||  |  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
12844050 gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttca 12844149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University