View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8824_high_12 (Length: 232)
Name: NF8824_high_12
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8824_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 12861599 - 12861369
Alignment:
| Q |
1 |
cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861599 |
cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat |
12861500 |
T |
|
| Q |
101 |
tgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12861499 |
tgaacgccgaggccgacaacaagattacagttgcggaggtattgaaggtgatgatcgagcatagtacggagccagtttgttacaacggaagcagtggcgg |
12861400 |
T |
|
| Q |
201 |
taacggtgacttcgaagttgatttggctttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12861399 |
taacggtgacttcgaagttgatttggctttc |
12861369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 12843882 - 12844009
Alignment:
| Q |
1 |
cggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccat |
100 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
12843882 |
cggaatcatatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccat |
12843981 |
T |
|
| Q |
101 |
tgaacgccgaggccgacaacaagattac |
128 |
Q |
| |
|
|||||||| |||||||||| ||||||| |
|
|
| T |
12843982 |
tgaacgccaaggccgacaatgagattac |
12844009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 12844050 - 12844149
Alignment:
| Q |
133 |
gcggaggtattgaaggtgatgatcgagcattgtacggagccagtttgttacgacggaagcagtggcggtaacggtgacttcgaagttgatttggctttca |
232 |
Q |
| |
|
||||||| |||||| ||||||| |||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844050 |
gcggagggattgaaaatgatgattgagcatactttggagccagtttgttacgacggaagctgtggcggtaacggtgacttcgaagttgatttggctttca |
12844149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University