View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8824_low_11 (Length: 249)
Name: NF8824_low_11
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8824_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 45675460 - 45675677
Alignment:
| Q |
19 |
ttctcttattctcaattgaagaaaggagtatgtaaaaactttaatatttcatctaatgtaaatgtgagtattttaatttaattttacatactccatggct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
45675460 |
ttctcttattctcaattgaagaaaggagtatgtacgtactttaatatttcatctaatgtaaatgtgagtatcttaatttaattttacattctccatggct |
45675559 |
T |
 |
| Q |
119 |
agtaccatatgctgcttgagtgtatgtttcgttcactttgaagggatcaaaatcgacggtagagatgttatattgattttgatgtgtttgattgttttaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45675560 |
agtaccatatgctgcttgagtgtatgtttcgttcactttgaagggatcaaaatcgacggtagaaatgttatattgattttgatgtgtttgattgttttaa |
45675659 |
T |
 |
| Q |
219 |
agtagatttggtgtatct |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45675660 |
agtagatttggtgtatct |
45675677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University