View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8824_low_17 (Length: 228)
Name: NF8824_low_17
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8824_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 3502706 - 3502635
Alignment:
| Q |
12 |
aagcagagattaaccttgagacctcaattgcaaacagtaaacaaaatttcaccccttatagtacaaaccctc |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3502706 |
aagcaaagattaaccttgagacctcaattgcaaacagtaaacaaaatttcaccctttttagtacaaaccctc |
3502635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 214
Target Start/End: Complemental strand, 3502574 - 3502498
Alignment:
| Q |
144 |
gggtttacaataatgatgatataatacaaaaacaagaac------aagattatgaatgaaagtaagaccaaaaaagt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
3502574 |
gggtttacaataatgatgatataatacaagaacaagaacaagaacaagattatgaatgaaagtaagaacaaaaaagt |
3502498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University