View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8824_low_18 (Length: 219)
Name: NF8824_low_18
Description: NF8824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8824_low_18 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 18740 - 18536
Alignment:
| Q |
1 |
atattatcataattgatattccagcataatctagacgccnnnnnnncaggctaaagcgtttggagtggcaggcaagaagatgggaaactgaactgcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18740 |
atattatcataattgatattccggcataatctagacgccaaaaaaacaggccaaatcgtttggagtggcaagcaagaagatgggaaactgaactgcaaag |
18641 |
T |
 |
| Q |
101 |
taagcaacacattcctccacctaagaaaatgaaccatggccatcttggaattgtttctgttccatattctctcaccctatcaaaaatggatacttccaaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18640 |
taagcagcacattcctccacctaagaaaatgaaccatggccatcttggaattgtttctgttccatattctctcaccctatcaaaaatggatacttccaaa |
18541 |
T |
 |
| Q |
201 |
atctg |
205 |
Q |
| |
|
||||| |
|
|
| T |
18540 |
atctg |
18536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University