View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8825_high_4 (Length: 396)
Name: NF8825_high_4
Description: NF8825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8825_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 20 - 379
Target Start/End: Complemental strand, 37379394 - 37379035
Alignment:
| Q |
20 |
gacgggatggtgataaacttggctacacttttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37379394 |
gacgggatggtgataaacttggctacacttttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggagg |
37379295 |
T |
 |
| Q |
120 |
ctgtgacggcgtgtactggtgttttcggaagtggcgcttatccgggttatgcgggtcgggttcttgttgatggggcaagtggatcgagctacaatgcgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37379294 |
ctgtgacggcgtgtactggtgttttcggaagtggcgcttatccgggttatgcgggtcgtgttcttgttgatggggcaagtggatcgagctacaatgcgca |
37379195 |
T |
 |
| Q |
220 |
cggtgctaatgggaggaagtaccttttgccggcgatgtgggaccctcaaacttcggcatgcaagactctcgtctaaggtggggaccggataattgacacg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37379194 |
cggtgctaatgggaggaagtaccttttgccggcgatgtgggaccctcaaacttcggcatgcaagactctcgtctaaggtggggaccggataattgacacg |
37379095 |
T |
 |
| Q |
320 |
tggcataatatggtgtagatatatatggtgggttgataagtatggggcaggtgaatgatg |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37379094 |
tggcataatatggtgtagatatatatggtgggttgataaatatggggcaggtgaatgatg |
37379035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 50 - 270
Target Start/End: Original strand, 1760981 - 1761201
Alignment:
| Q |
50 |
ttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggaggctgtgacggcgtgtactggtgttttcggaa |
149 |
Q |
| |
|
||||| ||||||||||| ||||||||||| | ||| |||||||| || ||| || ||||||| || |||||||| |||| || || || || || |||| |
|
|
| T |
1760981 |
ttggctggtaccgttacaaatccgtttaataccggatattttcaaggtccaccaacggcgccattagaggctgtttcggcttgcaccggggtgtttggaa |
1761080 |
T |
 |
| Q |
150 |
gtggcgcttatccgggttatgcgggtcgggttcttgttgatggggcaagtggatcgagctacaatgcgcacggtgctaatgggaggaagtaccttttgcc |
249 |
Q |
| |
|
|||| || |||||||||||| ||||||||||| || | | || | ||| ||||||| |||||||| || | ||||| ||||||||| | ||||| |
|
|
| T |
1761081 |
gtggagcgtatccgggttatccgggtcgggttatttggaacagagctactggtgcgagctataatgcgcatggagtgaatggtaggaagtacttgttgcc |
1761180 |
T |
 |
| Q |
250 |
ggcgatgtgggaccctcaaac |
270 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
1761181 |
agcgatgtgggacccgcaaac |
1761201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University