View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8825_high_4 (Length: 396)

Name: NF8825_high_4
Description: NF8825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8825_high_4
NF8825_high_4
[»] chr4 (1 HSPs)
chr4 (20-379)||(37379035-37379394)
[»] chr2 (1 HSPs)
chr2 (50-270)||(1760981-1761201)


Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 20 - 379
Target Start/End: Complemental strand, 37379394 - 37379035
Alignment:
20 gacgggatggtgataaacttggctacacttttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggagg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37379394 gacgggatggtgataaacttggctacacttttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggagg 37379295  T
120 ctgtgacggcgtgtactggtgttttcggaagtggcgcttatccgggttatgcgggtcgggttcttgttgatggggcaagtggatcgagctacaatgcgca 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
37379294 ctgtgacggcgtgtactggtgttttcggaagtggcgcttatccgggttatgcgggtcgtgttcttgttgatggggcaagtggatcgagctacaatgcgca 37379195  T
220 cggtgctaatgggaggaagtaccttttgccggcgatgtgggaccctcaaacttcggcatgcaagactctcgtctaaggtggggaccggataattgacacg 319  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37379194 cggtgctaatgggaggaagtaccttttgccggcgatgtgggaccctcaaacttcggcatgcaagactctcgtctaaggtggggaccggataattgacacg 37379095  T
320 tggcataatatggtgtagatatatatggtgggttgataagtatggggcaggtgaatgatg 379  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
37379094 tggcataatatggtgtagatatatatggtgggttgataaatatggggcaggtgaatgatg 37379035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 50 - 270
Target Start/End: Original strand, 1760981 - 1761201
Alignment:
50 ttggccggtaccgttacgaatccgtttaacaacgggtattttcagggaccagcagcggcgccgttggaggctgtgacggcgtgtactggtgttttcggaa 149  Q
    ||||| ||||||||||| ||||||||||| | ||| |||||||| || ||| || ||||||| || ||||||||  |||| || || || || || ||||    
1760981 ttggctggtaccgttacaaatccgtttaataccggatattttcaaggtccaccaacggcgccattagaggctgtttcggcttgcaccggggtgtttggaa 1761080  T
150 gtggcgcttatccgggttatgcgggtcgggttcttgttgatggggcaagtggatcgagctacaatgcgcacggtgctaatgggaggaagtaccttttgcc 249  Q
    |||| || |||||||||||| ||||||||||| ||    |  | || | |||  ||||||| |||||||| || |  ||||| ||||||||| | |||||    
1761081 gtggagcgtatccgggttatccgggtcgggttatttggaacagagctactggtgcgagctataatgcgcatggagtgaatggtaggaagtacttgttgcc 1761180  T
250 ggcgatgtgggaccctcaaac 270  Q
     |||||||||||||| |||||    
1761181 agcgatgtgggacccgcaaac 1761201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University