View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8825_low_10 (Length: 239)
Name: NF8825_low_10
Description: NF8825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8825_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11473692 - 11473470
Alignment:
| Q |
1 |
ttcaattcatgggcataaaatcttttaaactttgcacatttcataaaatattccactcaccttgttcatcagtttaattatttgattattaatttgagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11473692 |
ttcaattcatgggcataaaatctttttaactttgcacatttcataaaatattccactcaccttgttcatcagtttaattatttgattattaatttgagac |
11473593 |
T |
 |
| Q |
101 |
gttttccaagcatgtaggtatgattctcgagttagagatcttttggacttcagtatctacttagatattagcaatgaggtgaaatttgcttgg-aaattc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11473592 |
gttttccaagcatgtaggtatgattctcgagttagagatcttttggacttcagtatctacttagatattagcaatgaggtgaaatttgcttggaaaattc |
11473493 |
T |
 |
| Q |
200 |
aggtaaagacactactataattc |
222 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
11473492 |
aggtaaaaacactactataattc |
11473470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University