View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8825_low_9 (Length: 260)
Name: NF8825_low_9
Description: NF8825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8825_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49256391 - 49256155
Alignment:
| Q |
1 |
aatcgtgctgcgtgtggacatccagctcctaatgcatttgaaactcttgcactgaataacacaacgaaaagaaaaaccaaacacaaacaaagaaatagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256391 |
aatcgtgctgcgtgtggacatccagctcctaatgcatttgaaactcttgcactgaatgacacaacgaaaagaaaaaccaaacacaaacaaagaaatagca |
49256292 |
T |
 |
| Q |
101 |
tcactttttatttgtacagaaaaatgtgtatgcacaaattgaatgggttttgaatgatgtgaatcaaaaccttgctgctgagccagttgcttctggtatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256291 |
tcactttttatttgtacagaaaaatgtgtatgcacaaattgaatgggttttgaatgatgtgaatcaaaaccttgctgctgagccagttgcttctggtatt |
49256192 |
T |
 |
| Q |
201 |
gtatatagtgttgagatgattgacaaactggtcatgg |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49256191 |
gtatagagtgttgagatgattgacaaactggtcatgg |
49256155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 49269218 - 49269145
Alignment:
| Q |
157 |
atgtgaatcaaaaccttgctgctgagccagttgcttctggtattgtatatagtgttgagatgattgacaaactg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
49269218 |
atgtgaatcaaaaccttgctgctgagccagttgcttctggtattgtatagattgttgagatgattgataaactg |
49269145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 49269349 - 49269303
Alignment:
| Q |
1 |
aatcgtgctgcgtgtggacatccagctcctaatgcatttgaaactct |
47 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
49269349 |
aatcgcgctgcttgtggacatccacctcctaatgcatttgaaactct |
49269303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University