View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8826_high_1 (Length: 643)

Name: NF8826_high_1
Description: NF8826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8826_high_1
NF8826_high_1
[»] chr7 (59 HSPs)
chr7 (13-606)||(39123437-39124030)
chr7 (444-606)||(42805502-42805661)
chr7 (445-606)||(47716438-47716596)
chr7 (444-606)||(21172009-21172164)
chr7 (444-606)||(10693073-10693228)
chr7 (444-606)||(32758239-32758394)
chr7 (444-606)||(40463855-40464011)
chr7 (448-606)||(42391100-42391251)
chr7 (444-606)||(27629612-27629769)
chr7 (444-606)||(42798647-42798804)
chr7 (444-606)||(43557450-43557610)
chr7 (444-606)||(48735122-48735278)
chr7 (444-602)||(33871914-33872066)
chr7 (444-606)||(2541019-2541177)
chr7 (444-577)||(46354172-46354302)
chr7 (444-606)||(22698967-22699127)
chr7 (444-605)||(11617589-11617745)
chr7 (444-605)||(29907395-29907552)
chr7 (444-606)||(34626208-34626364)
chr7 (433-606)||(19265782-19265948)
chr7 (444-605)||(42476851-42477005)
chr7 (472-606)||(7879644-7879773)
chr7 (444-606)||(19426890-19427046)
chr7 (519-607)||(45018922-45019012)
chr7 (433-605)||(3469176-3469347)
chr7 (433-586)||(28362165-28362313)
chr7 (444-594)||(47077867-47078010)
chr7 (518-606)||(27889316-27889402)
chr7 (433-586)||(13805069-13805216)
chr7 (444-604)||(35334818-35334971)
chr7 (444-614)||(14732813-14732979)
chr7 (521-606)||(31591109-31591192)
chr7 (444-605)||(16341256-16341413)
chr7 (446-587)||(28078151-28078286)
chr7 (445-605)||(11741774-11741927)
chr7 (472-604)||(18512455-18512581)
chr7 (519-594)||(21566485-21566559)
chr7 (452-605)||(18747472-18747621)
chr7 (433-606)||(23419674-23419842)
chr7 (449-611)||(32233130-32233286)
chr7 (497-587)||(38604558-38604642)
chr7 (497-606)||(35787269-35787372)
chr7 (444-517)||(42495919-42495992)
chr7 (444-585)||(19266428-19266564)
chr7 (525-591)||(33500569-33500635)
chr7 (457-606)||(38262196-38262340)
chr7 (433-582)||(48123508-48123652)
chr7 (444-517)||(18327012-18327085)
chr7 (444-508)||(7193063-7193127)
chr7 (521-594)||(23231609-23231680)
chr7 (433-510)||(7644923-7645000)
chr7 (555-603)||(42495865-42495913)
chr7 (444-559)||(5180202-5180314)
chr7 (472-587)||(35203445-35203557)
chr7 (559-606)||(36602535-36602582)
chr7 (444-510)||(7794597-7794663)
chr7 (444-517)||(6736868-6736941)
chr7 (444-517)||(44123705-44123778)
chr7 (534-606)||(23987383-23987455)
[»] chr2 (67 HSPs)
chr2 (433-607)||(10543664-10543836)
chr2 (439-606)||(5841001-5841165)
chr2 (444-606)||(14530296-14530455)
chr2 (444-606)||(24200623-24200782)
chr2 (444-606)||(8455316-8455473)
chr2 (446-606)||(21779261-21779414)
chr2 (444-606)||(9671158-9671314)
chr2 (444-606)||(25249738-25249894)
chr2 (457-606)||(14444720-14444863)
chr2 (444-602)||(7214512-7214667)
chr2 (444-594)||(12023931-12024075)
chr2 (444-606)||(23397744-23397899)
chr2 (457-611)||(10546153-10546303)
chr2 (444-609)||(25079714-25079875)
chr2 (444-606)||(17896237-17896395)
chr2 (482-611)||(36871509-36871631)
chr2 (444-606)||(14544041-14544201)
chr2 (444-606)||(11514414-11514570)
chr2 (444-606)||(17667980-17668137)
chr2 (444-606)||(17623542-17623699)
chr2 (444-568)||(22371035-22371151)
chr2 (533-606)||(23488545-23488618)
chr2 (546-606)||(34080176-34080236)
chr2 (552-607)||(3633707-3633762)
chr2 (545-604)||(41409936-41409995)
chr2 (444-590)||(99281-99420)
chr2 (444-594)||(31158451-31158598)
chr2 (545-605)||(40579750-40579810)
chr2 (433-606)||(44643489-44643658)
chr2 (433-603)||(4516354-4516519)
chr2 (551-606)||(8575975-8576030)
chr2 (444-586)||(21377093-21377230)
chr2 (521-607)||(40762233-40762317)
chr2 (444-603)||(45235820-45235975)
chr2 (446-606)||(19977714-19977869)
chr2 (451-612)||(25641487-25641642)
chr2 (444-544)||(29419945-29420046)
chr2 (444-606)||(39914306-39914463)
chr2 (455-595)||(19614981-19615117)
chr2 (546-606)||(34766330-34766390)
chr2 (444-568)||(5450263-5450383)
chr2 (433-616)||(17380228-17380404)
chr2 (444-594)||(24860000-24860143)
chr2 (521-607)||(25632561-25632645)
chr2 (555-602)||(39189508-39189555)
chr2 (444-606)||(40416871-40417028)
chr2 (543-605)||(13245096-13245158)
chr2 (444-606)||(27573599-27573755)
chr2 (521-593)||(24890463-24890533)
chr2 (497-606)||(30826068-30826170)
chr2 (433-597)||(32781298-32781456)
chr2 (444-517)||(44604832-44604905)
chr2 (558-606)||(22371199-22371247)
chr2 (544-606)||(1289095-1289158)
chr2 (526-589)||(19185760-19185823)
chr2 (543-593)||(4794874-4794924)
chr2 (558-607)||(124913-124962)
chr2 (444-586)||(33795263-33795400)
chr2 (521-594)||(44449395-44449467)
chr2 (444-508)||(17705473-17705537)
chr2 (543-594)||(26684632-26684683)
chr2 (543-593)||(31523303-31523353)
chr2 (525-594)||(17471605-17471673)
chr2 (444-568)||(23145736-23145855)
chr2 (444-568)||(23557526-23557645)
chr2 (545-590)||(24059012-24059057)
chr2 (543-603)||(31525778-31525838)
[»] chr6 (39 HSPs)
chr6 (526-643)||(12892064-12892181)
chr6 (449-606)||(29355855-29356009)
chr6 (444-606)||(9161101-9161259)
chr6 (444-606)||(12221914-12222074)
chr6 (444-606)||(1346942-1347097)
chr6 (444-606)||(1354757-1354912)
chr6 (444-606)||(2166410-2166569)
chr6 (444-606)||(2178043-2178202)
chr6 (533-607)||(14975089-14975163)
chr6 (525-606)||(12885967-12886048)
chr6 (521-606)||(26097210-26097293)
chr6 (444-574)||(6024211-6024338)
chr6 (544-606)||(6808468-6808530)
chr6 (521-606)||(25557775-25557858)
chr6 (533-606)||(3116129-3116202)
chr6 (444-599)||(3815084-3815234)
chr6 (458-606)||(17432332-17432483)
chr6 (543-606)||(13267797-13267860)
chr6 (543-606)||(24097649-24097712)
chr6 (521-606)||(7947371-7947455)
chr6 (545-606)||(23930127-23930188)
chr6 (551-611)||(20906781-20906841)
chr6 (543-599)||(32579497-32579553)
chr6 (521-605)||(2755422-2755507)
chr6 (433-510)||(13905070-13905147)
chr6 (546-606)||(10734905-10734965)
chr6 (444-510)||(8409221-8409287)
chr6 (444-510)||(14975171-14975237)
chr6 (441-510)||(12063442-12063511)
chr6 (527-606)||(383760-383837)
chr6 (546-594)||(11395836-11395884)
chr6 (444-593)||(15866052-15866194)
chr6 (533-599)||(16895704-16895771)
chr6 (533-592)||(19340891-19340949)
chr6 (521-588)||(24734694-24734760)
chr6 (547-606)||(33922857-33922916)
chr6 (444-494)||(33922935-33922985)
chr6 (553-602)||(30786378-30786427)
chr6 (433-468)||(19649300-19649336)
[»] chr3 (69 HSPs)
chr3 (444-611)||(13730597-13730761)
chr3 (445-606)||(13628790-13628948)
chr3 (444-606)||(46421034-46421194)
chr3 (444-606)||(29366720-29366879)
chr3 (444-606)||(39203516-39203671)
chr3 (444-605)||(22122918-22123072)
chr3 (433-605)||(22609755-22609921)
chr3 (444-606)||(40272812-40272969)
chr3 (444-606)||(1217090-1217245)
chr3 (472-606)||(10795423-10795554)
chr3 (444-606)||(26869707-26869863)
chr3 (444-604)||(8247688-8247846)
chr3 (445-606)||(5173719-5173876)
chr3 (521-604)||(353351-353434)
chr3 (444-606)||(16735441-16735597)
chr3 (444-589)||(9607203-9607345)
chr3 (521-606)||(49013473-49013558)
chr3 (433-604)||(26573116-26573282)
chr3 (452-606)||(516417-516569)
chr3 (444-606)||(34420643-34420801)
chr3 (480-607)||(14986993-14987117)
chr3 (473-607)||(31592878-31593005)
chr3 (521-606)||(45786214-45786299)
chr3 (521-606)||(54484765-54484848)
chr3 (444-606)||(25944469-25944627)
chr3 (444-606)||(12914035-12914192)
chr3 (444-594)||(6411834-6411978)
chr3 (521-606)||(15797294-15797377)
chr3 (455-590)||(33926094-33926224)
chr3 (521-606)||(34771364-34771447)
chr3 (444-606)||(52926219-52926367)
chr3 (444-605)||(7696893-7697042)
chr3 (521-602)||(54374349-54374429)
chr3 (543-606)||(24851301-24851364)
chr3 (444-535)||(10870021-10870108)
chr3 (444-606)||(53996565-53996723)
chr3 (446-586)||(30928167-30928302)
chr3 (523-606)||(25517170-25517251)
chr3 (546-606)||(30452892-30452952)
chr3 (455-605)||(45139479-45139624)
chr3 (451-611)||(12525414-12525569)
chr3 (543-592)||(35417998-35418047)
chr3 (526-594)||(829454-829521)
chr3 (551-606)||(10484616-10484671)
chr3 (433-542)||(45620890-45620997)
chr3 (433-594)||(45948850-45949009)
chr3 (497-568)||(47624095-47624160)
chr3 (447-602)||(7942993-7943143)
chr3 (558-606)||(47624208-47624256)
chr3 (543-606)||(46169967-46170030)
chr3 (444-517)||(53062038-53062112)
chr3 (444-556)||(4495714-4495821)
chr3 (560-612)||(6242279-6242331)
chr3 (542-594)||(44403567-44403619)
chr3 (563-606)||(4495676-4495719)
chr3 (543-606)||(24577929-24577992)
chr3 (543-606)||(24578019-24578082)
chr3 (543-606)||(26292424-26292487)
chr3 (550-605)||(45288056-45288111)
chr3 (563-606)||(54032571-54032614)
chr3 (542-592)||(40968611-40968661)
chr3 (546-607)||(14266371-14266431)
chr3 (561-606)||(31831298-31831343)
chr3 (433-510)||(35417905-35417982)
chr3 (573-606)||(40390365-40390398)
chr3 (525-586)||(55401254-55401314)
chr3 (542-606)||(10696213-10696277)
chr3 (573-605)||(31922840-31922872)
chr3 (573-605)||(33235655-33235687)
[»] chr5 (58 HSPs)
chr5 (444-606)||(41014297-41014453)
chr5 (444-606)||(4619104-4619263)
chr5 (444-606)||(38879559-38879718)
chr5 (444-606)||(43334180-43334339)
chr5 (453-606)||(32703411-32703557)
chr5 (444-592)||(27328730-27328875)
chr5 (444-606)||(8169984-8170139)
chr5 (475-606)||(13801767-13801895)
chr5 (444-606)||(24448868-24449025)
chr5 (444-606)||(35710291-35710446)
chr5 (521-605)||(20135656-20135740)
chr5 (433-593)||(19142956-19143110)
chr5 (521-606)||(34154814-34154897)
chr5 (535-607)||(25622524-25622596)
chr5 (543-606)||(16957386-16957449)
chr5 (433-594)||(43574564-43574729)
chr5 (481-603)||(7368413-7368528)
chr5 (444-606)||(28516433-28516591)
chr5 (497-606)||(7097760-7097863)
chr5 (533-605)||(12006329-12006401)
chr5 (444-606)||(1565409-1565566)
chr5 (547-606)||(16028624-16028683)
chr5 (441-594)||(22861681-22861826)
chr5 (444-606)||(22187263-22187422)
chr5 (444-594)||(208939-209084)
chr5 (433-594)||(39301090-39301246)
chr5 (444-583)||(2838756-2838890)
chr5 (547-606)||(30877564-30877623)
chr5 (521-606)||(16880647-16880730)
chr5 (444-509)||(37024646-37024711)
chr5 (526-606)||(12575660-12575739)
chr5 (444-586)||(22600432-22600569)
chr5 (533-587)||(10306493-10306546)
chr5 (542-595)||(4654426-4654479)
chr5 (521-606)||(11657699-11657783)
chr5 (521-594)||(12477132-12477204)
chr5 (542-603)||(21784335-21784396)
chr5 (433-510)||(23974747-23974824)
chr5 (521-606)||(29334447-29334531)
chr5 (550-606)||(10943845-10943900)
chr5 (546-602)||(39801591-39801647)
chr5 (562-605)||(19438757-19438800)
chr5 (555-606)||(32354211-32354262)
chr5 (544-594)||(29297864-29297914)
chr5 (526-606)||(1405244-1405322)
chr5 (546-606)||(3771414-3771474)
chr5 (451-558)||(22907913-22908014)
chr5 (521-608)||(42924828-42924917)
chr5 (543-584)||(21542489-21542530)
chr5 (439-468)||(28208240-28208269)
chr5 (546-606)||(5873322-5873382)
chr5 (433-493)||(10634254-10634314)
chr5 (436-468)||(12622192-12622224)
chr5 (542-606)||(19093884-19093948)
chr5 (573-605)||(29184062-29184094)
chr5 (446-510)||(34074653-34074717)
chr5 (533-593)||(39079764-39079823)
chr5 (433-485)||(39079882-39079934)
[»] chr4 (81 HSPs)
chr4 (444-606)||(16408601-16408760)
chr4 (444-606)||(5648237-5648393)
chr4 (444-606)||(30639358-30639514)
chr4 (444-605)||(6430627-6430782)
chr4 (444-607)||(20224962-20225118)
chr4 (444-603)||(21646942-21647098)
chr4 (444-606)||(16911540-16911699)
chr4 (444-606)||(44363130-44363289)
chr4 (444-606)||(48598825-48598980)
chr4 (433-606)||(54175031-54175200)
chr4 (444-606)||(23501771-23501924)
chr4 (444-606)||(11054148-11054303)
chr4 (444-606)||(47528530-47528685)
chr4 (521-606)||(20225126-20225211)
chr4 (444-611)||(30352575-30352748)
chr4 (444-605)||(40915807-40915962)
chr4 (444-594)||(54730227-54730375)
chr4 (458-604)||(29207900-29208039)
chr4 (444-606)||(5306660-5306820)
chr4 (444-606)||(13256399-13256554)
chr4 (483-611)||(20639653-20639777)
chr4 (443-606)||(9832313-9832469)
chr4 (446-603)||(17043398-17043549)
chr4 (444-607)||(20405071-20405225)
chr4 (533-613)||(33836480-33836560)
chr4 (472-606)||(47443963-47444092)
chr4 (521-606)||(25629101-25629184)
chr4 (521-606)||(20908636-20908720)
chr4 (452-606)||(25463108-25463256)
chr4 (444-606)||(30690176-30690340)
chr4 (545-606)||(32484307-32484368)
chr4 (543-612)||(38786681-38786750)
chr4 (447-611)||(39077791-39077948)
chr4 (484-610)||(7909276-7909397)
chr4 (444-606)||(35567148-35567305)
chr4 (433-603)||(25343154-25343321)
chr4 (440-606)||(32478792-32478946)
chr4 (544-606)||(38755908-38755970)
chr4 (445-588)||(49938611-49938746)
chr4 (433-568)||(47441568-47441698)
chr4 (521-605)||(8473621-8473705)
chr4 (543-606)||(11394924-11394987)
chr4 (543-606)||(11404651-11404714)
chr4 (543-606)||(14983906-14983969)
chr4 (436-594)||(19027818-19027971)
chr4 (545-606)||(40553937-40553998)
chr4 (523-606)||(36816384-36816466)
chr4 (495-606)||(48327763-48327871)
chr4 (555-606)||(56322984-56323035)
chr4 (544-606)||(25388249-25388311)
chr4 (538-592)||(47482864-47482918)
chr4 (521-594)||(51865050-51865121)
chr4 (546-606)||(19027986-19028046)
chr4 (444-588)||(39029078-39029218)
chr4 (433-517)||(42164232-42164316)
chr4 (433-590)||(30581481-30581635)
chr4 (444-510)||(14590815-14590881)
chr4 (556-606)||(35532077-35532127)
chr4 (444-517)||(17315382-17315455)
chr4 (444-592)||(37494829-37494972)
chr4 (545-606)||(44718641-44718702)
chr4 (521-585)||(49796849-49796911)
chr4 (525-593)||(21489143-21489210)
chr4 (449-593)||(41018807-41018945)
chr4 (444-607)||(55766465-55766623)
chr4 (444-607)||(55830720-55830878)
chr4 (444-594)||(487138-487292)
chr4 (543-594)||(28494223-28494274)
chr4 (544-611)||(50555651-50555718)
chr4 (433-603)||(54966988-54967151)
chr4 (521-594)||(9987846-9987917)
chr4 (521-606)||(10277757-10277840)
chr4 (524-590)||(16494272-16494338)
chr4 (444-510)||(23580299-23580365)
chr4 (525-608)||(2813181-2813265)
chr4 (449-583)||(7385499-7385628)
chr4 (544-606)||(8820581-8820643)
chr4 (451-517)||(32629352-32629418)
chr4 (433-510)||(54640430-54640507)
chr4 (557-597)||(37038132-37038172)
chr4 (433-493)||(50856344-50856404)
[»] chr1 (72 HSPs)
chr1 (444-606)||(30395726-30395885)
chr1 (444-606)||(20004090-20004249)
chr1 (444-606)||(32632557-32632713)
chr1 (444-606)||(34725098-34725253)
chr1 (444-606)||(18944644-18944804)
chr1 (439-606)||(27201643-27201807)
chr1 (444-606)||(38478282-38478437)
chr1 (444-606)||(46247953-46248110)
chr1 (444-606)||(47214512-47214667)
chr1 (444-606)||(14617039-14617196)
chr1 (444-606)||(19414440-19414595)
chr1 (444-606)||(27474282-27474438)
chr1 (457-606)||(10668239-10668385)
chr1 (433-586)||(11596503-11596650)
chr1 (459-606)||(35005139-35005283)
chr1 (433-602)||(45812541-45812704)
chr1 (457-606)||(35253187-35253329)
chr1 (533-606)||(50606488-50606561)
chr1 (444-607)||(35117764-35117925)
chr1 (444-603)||(46991805-46991959)
chr1 (433-595)||(18724557-18724713)
chr1 (444-606)||(41319806-41319963)
chr1 (444-606)||(18741957-18742118)
chr1 (521-606)||(4349713-4349796)
chr1 (445-606)||(9939463-9939622)
chr1 (444-603)||(45402096-45402251)
chr1 (444-592)||(23768334-23768477)
chr1 (444-594)||(6925101-6925246)
chr1 (521-604)||(19932755-19932838)
chr1 (444-606)||(12126837-12126992)
chr1 (484-606)||(31382214-31382330)
chr1 (433-594)||(2435798-2435955)
chr1 (444-611)||(19701571-19701734)
chr1 (521-606)||(42304207-42304292)
chr1 (475-604)||(22324925-22325049)
chr1 (446-612)||(8197046-8197207)
chr1 (521-603)||(10378738-10378818)
chr1 (433-606)||(6983811-6983977)
chr1 (433-508)||(20036210-20036285)
chr1 (521-611)||(23796540-23796628)
chr1 (521-606)||(1517311-1517394)
chr1 (543-601)||(4587568-4587626)
chr1 (433-604)||(15511150-15511319)
chr1 (444-561)||(17470390-17470503)
chr1 (444-517)||(22930151-22930224)
chr1 (444-576)||(25290164-25290300)
chr1 (444-584)||(25468285-25468420)
chr1 (533-594)||(45264411-45264471)
chr1 (444-557)||(33222985-33223093)
chr1 (551-606)||(16120819-16120874)
chr1 (433-606)||(50811929-50812098)
chr1 (543-611)||(30555210-30555278)
chr1 (546-593)||(33594144-33594191)
chr1 (444-586)||(44485129-44485266)
chr1 (525-586)||(15505643-15505702)
chr1 (556-606)||(19386576-19386626)
chr1 (521-606)||(20999850-20999933)
chr1 (521-599)||(31442396-31442473)
chr1 (521-606)||(43768214-43768297)
chr1 (445-510)||(22327101-22327166)
chr1 (543-600)||(30682907-30682963)
chr1 (433-542)||(50760288-50760394)
chr1 (542-597)||(1693220-1693276)
chr1 (523-595)||(7074593-7074664)
chr1 (547-586)||(20169109-20169148)
chr1 (433-520)||(25554803-25554890)
chr1 (444-487)||(40424743-40424786)
chr1 (444-510)||(2435984-2436050)
chr1 (524-590)||(6358199-6358264)
chr1 (553-603)||(28894561-28894611)
chr1 (521-606)||(19974074-19974158)
chr1 (521-613)||(35019305-35019394)
[»] chr8 (51 HSPs)
chr8 (444-606)||(7136527-7136686)
chr8 (444-606)||(13160680-13160836)
chr8 (444-611)||(6760800-6760964)
chr8 (444-606)||(12670250-12670405)
chr8 (444-606)||(39460994-39461153)
chr8 (444-606)||(36720774-36720931)
chr8 (444-606)||(30454097-30454252)
chr8 (444-600)||(21070703-21070859)
chr8 (444-606)||(26954110-26954270)
chr8 (444-606)||(28817626-28817783)
chr8 (444-606)||(35261657-35261814)
chr8 (444-600)||(20284075-20284230)
chr8 (484-606)||(20869941-20870060)
chr8 (444-605)||(45071243-45071398)
chr8 (444-606)||(17823554-17823711)
chr8 (444-606)||(25250500-25250659)
chr8 (444-607)||(2626497-2626658)
chr8 (446-602)||(18164764-18164914)
chr8 (433-607)||(29521684-29521854)
chr8 (433-593)||(44781517-44781674)
chr8 (525-606)||(16225075-16225156)
chr8 (444-606)||(8897764-8897921)
chr8 (444-606)||(44530127-44530284)
chr8 (444-583)||(20869523-20869653)
chr8 (444-586)||(24365079-24365217)
chr8 (521-604)||(29877146-29877227)
chr8 (444-606)||(12625867-12626025)
chr8 (526-606)||(16013511-16013591)
chr8 (543-611)||(26102589-26102657)
chr8 (444-607)||(28407394-28407539)
chr8 (444-587)||(24245429-24245565)
chr8 (433-592)||(42083712-42083867)
chr8 (472-606)||(5135290-5135418)
chr8 (521-606)||(19729392-19729475)
chr8 (448-606)||(31457155-31457307)
chr8 (452-606)||(23000228-23000365)
chr8 (546-605)||(27507985-27508044)
chr8 (543-606)||(35107311-35107374)
chr8 (521-606)||(10857881-10857964)
chr8 (557-606)||(27468092-27468141)
chr8 (521-562)||(43942376-43942417)
chr8 (449-577)||(11748282-11748407)
chr8 (521-593)||(17250888-17250960)
chr8 (521-594)||(5689683-5689754)
chr8 (521-594)||(8483950-8484021)
chr8 (521-603)||(44742521-44742602)
chr8 (433-585)||(14017989-14018137)
chr8 (445-568)||(35105902-35106021)
chr8 (545-605)||(36486567-36486627)
chr8 (539-602)||(18595906-18595969)
chr8 (445-510)||(30962864-30962929)
[»] scaffold0168 (1 HSPs)
scaffold0168 (444-606)||(30557-30712)
[»] scaffold0258 (1 HSPs)
scaffold0258 (444-606)||(13024-13180)
[»] scaffold0049 (1 HSPs)
scaffold0049 (452-606)||(58963-59114)
[»] scaffold1176 (1 HSPs)
scaffold1176 (444-613)||(1580-1742)
[»] scaffold0057 (4 HSPs)
scaffold0057 (444-612)||(46809-46972)
scaffold0057 (444-606)||(24772-24924)
scaffold0057 (521-606)||(43709-43793)
scaffold0057 (542-603)||(46710-46771)
[»] scaffold0187 (2 HSPs)
scaffold0187 (444-604)||(10052-10205)
scaffold0187 (444-604)||(20380-20533)
[»] scaffold0223 (1 HSPs)
scaffold0223 (444-606)||(11110-11264)
[»] scaffold0015 (1 HSPs)
scaffold0015 (521-606)||(48634-48717)
[»] scaffold0311 (1 HSPs)
scaffold0311 (444-606)||(10788-10945)
[»] scaffold0180 (1 HSPs)
scaffold0180 (521-606)||(24133-24216)
[»] scaffold0018 (1 HSPs)
scaffold0018 (472-607)||(72866-72997)
[»] scaffold0254 (1 HSPs)
scaffold0254 (444-568)||(4135-4257)
[»] scaffold0005 (1 HSPs)
scaffold0005 (444-510)||(226497-226563)
[»] scaffold0954 (1 HSPs)
scaffold0954 (521-594)||(3596-3667)
[»] scaffold0031 (1 HSPs)
scaffold0031 (444-513)||(43107-43176)
[»] scaffold0036 (1 HSPs)
scaffold0036 (452-561)||(35062-35167)
[»] scaffold0024 (1 HSPs)
scaffold0024 (444-485)||(83853-83894)
[»] scaffold0692 (1 HSPs)
scaffold0692 (615-643)||(6452-6480)
[»] scaffold0194 (1 HSPs)
scaffold0194 (441-493)||(24639-24691)


Alignment Details
Target: chr7 (Bit Score: 537; Significance: 0; HSPs: 59)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 537; E-Value: 0
Query Start/End: Original strand, 13 - 606
Target Start/End: Original strand, 39123437 - 39124030
Alignment:
13 atggacatcattttattcaatttgacttggtttaatatcttacaaaagaaaaaagcagggtcaaatcagttcctttggatttataagggagaagaatgaa 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39123437 atggccatcattttattcaatttgacttggtttaatatcttacaaaagaaaaaagcagggtcaaatcagttcctttggatttataagggagaagaatgaa 39123536  T
113 actgtttaaatatgctactcattttaaggcgtgtaactctgtgttcacttcacatattaatgtgataattatatgtaaaactgtgaagaatttttggaaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39123537 actgtttaaatatgctactcattttaaggcgtgtaactctgtgttcacttcacatattaatgtgataattatatgtaaaactgtgaagaatttttggaaa 39123636  T
213 gttttttatatatacattgtttggagtctgctgcatgtttaacattagacggagctttctttctaattgtgctttagattctgaaaaggaactcaatact 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39123637 gttttttatatatacattgtttggagtctgctgcatgtttaacattagacggagctttctttctaattgtgctttagattctgaaaaggaactcaatact 39123736  T
313 ccgattatgcannnnnnnatcttccacttttccatcttcgtaattctaaaatcaaagtttacatatttattcttcctgcatactagatattatatctttt 412  Q
    |||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39123737 ccgattatgcatttttttatcttccacttttccatcttcgtaattctaaaatcaaagtttacatatttattcttcctgcatactagatattatatctttt 39123836  T
413 aacaagagatcatttgtgggtggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaaca 512  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
39123837 aacaagagatcatttgtgggtggcgcaatggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaaca 39123936  T
513 gggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||| |||||||| | ||||||||    
39123937 gggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgcccttt 39124030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 42805502 - 42805661
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||| ||| ||||||||||    
42805502 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccaa 42805597  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42805598 taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 42805661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 445 - 606
Target Start/End: Original strand, 47716438 - 47716596
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||| |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||     
47716438 aaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaat 47716533  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
47716534 aatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt 47716596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 21172164 - 21172009
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||| ||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
21172164 taaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 21172070  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
21172069 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 21172009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 10693228 - 10693073
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||  ||||||    |||||||||| |||||||||||    
10693228 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaag-agggta----aggctgcgtacaatacaccaaa 10693134  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||  |||||||||||    
10693133 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt 10693073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 32758239 - 32758394
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||    |||||| ||| |||||||||||    
32758239 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgtgtacaatacaccaaa 32758333  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
32758334 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 32758394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 40463855 - 40464011
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||| ||||||| ||||||||||||||||| ||||    ||||||||||| ||||||||  |    
40463855 taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggt----aaggctgcgtataatacacc--a 40463948  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||| ||||||| || ||||||||||||| ||||||||  ||||||||||    
40463949 aatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttt 40464011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 448 - 606
Target Start/End: Complemental strand, 42391251 - 42391100
Alignment:
448 gttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatg 547  Q
    ||||||||||||||||||||| | ||||||| |||||||| ||||| |  |||||||||||| |||||||    |||||||||| |||||||||||  ||    
42391251 gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tg 42391159  T
548 gtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
42391158 gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 42391100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 27629612 - 27629769
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||| |||| |||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    ||| |||||||||||||||||    
27629612 taaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggttgcgtaaaatacaccaa 27629707  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||| ||| |||||||||| ||||| |||||||| |||||||||||    
27629708 a--tggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttt 27629769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 42798647 - 42798804
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||| | ||||| |||||||||||||||| || ||||    |||||||||| ||||||||||    
42798647 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggta----aggctgcgtacaatacaccaa 42798742  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||| ||||||||||| ||||||||||||||| ||||||| | |||||||||||    
42798743 a--tggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttt 42798804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 43557450 - 43557610
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || |||| |||||||| ||||| | |||||||||||||| ||| |||    |||||||||| ||||||||||    
43557450 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta----aggctgcgtacaatacaccaa 43557545  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccaggttgcccttt 606  Q
     |||||||||||||| |||||||| | || ||||||||||| ||||||||||| |||||||||||    
43557546 taatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcccttt 43557610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 48735278 - 48735122
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctag-aaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| | ||||   ||||||||||||| || ||||    |||||||||| ||||||||||    
48735278 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaa-cacggta----aggctgcgtacaatacaccaa 48735184  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
48735183 a--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 48735122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 602
Target Start/End: Complemental strand, 33872066 - 33871914
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | | ||||| |||||||| |||||   |||||||||||||||||| ||    |||||||||| |||||||||||    
33872066 taaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggata----aggctgcgtacaatacaccaaa 33871971  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
      ||||||||||||||||| ||||| |  |||||| |||||||||||||||||||||||    
33871970 --tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc 33871914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 2541177 - 2541019
Alignment:
444 taaagttgttgtcatgtgactg-aaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacacca 541  Q
    |||||||||||||||||||||| ||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    ||||||||||  ||||||||    
2541177 taaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtactatacacca 2541082  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||  ||||||||||||||||||| ||| || |||||||||||||||||||||| |||| ||||||    
2541081 aa--tggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttt 2541019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 444 - 577
Target Start/End: Original strand, 46354172 - 46354302
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||| || || | ||||||| |||||||| |||||   |||||||||||||| |||||||    |||||||||| ||||||||||    
46354172 taaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 46354267  T
543 aaatggtgggaccccttcccggaccccgcatatgc 577  Q
     ||||||||||||||||||||||||||||||||||    
46354268 taatggtgggaccccttcccggaccccgcatatgc 46354302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 22699127 - 22698967
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| |  | |||| |||||||| ||||  |||||||||||| ||||||||||    ||| ||||||| ||||||||||    
22699127 taaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggt----aagactgcgtacaatacaccaa 22699032  T
543 aaatggtgggaccc-cttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||  ||||||||||| |  |||||||||||| ||||||||| |||| ||||||    
22699031 aaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttacccttt 22698967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 444 - 605
Target Start/End: Complemental strand, 11617745 - 11617589
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| |||||   |||||||||||||| |||||||    || ||||||| ||||||||||    
11617745 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa 11617650  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |  |||||||||||||||| |||||| || ||||| ||| |||||||||||| ||||||||||    
11617649 a--tggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt 11617589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 444 - 605
Target Start/End: Original strand, 29907395 - 29907552
Alignment:
444 taaagttgttgt--catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||  ||||||||||||| | ||||||| |||||||||||||| | |||||||||||||| |  ||  | ||||||||||  |||||||||    
29907395 taaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaa-atagt--gtaaggctgcgttcaatacacca 29907491  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||| |||||||||||| |||||||||| |  |||||||||||||||||||||| ||||||||||    
29907492 aaa-tggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt 29907552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 34626364 - 34626208
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||| ||||| | ||| | | |||||||| ||||| | ||| |||||||||||||||||    |||||||||  |||||||||||    
34626364 taaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggta----aggctgcgttcaatacaccaaa 34626269  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      |||||||| |||||||||||||| || ||||||||||||||||| || | |||||||||||    
34626268 --tggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcccttt 34626208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 433 - 606
Target Start/End: Original strand, 19265782 - 19265948
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||| | |||||||||||||| |||||||||| | ||||||| |||||| | || || | | |||||||||||| |||||    |||||||||||     
19265782 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggt----aaggctgcgtac 19265877  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||  ||||||||||||||||||||||| ||  |||||| ||||||||||||||||| || ||||||||    
19265878 aatacacc--aaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgcccttt 19265948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 444 - 605
Target Start/End: Original strand, 42476851 - 42477005
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||| ||| | ||||| | ||||| || ||||| ||||||||||||||| || ||||    |||||||||| |||||||||||    
42476851 taaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaa-caaggta----aggctgcgtacaatacaccaaa 42476945  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
      ||||||||||||||||  | | | ||||||||||||||| ||||||||||||||||||||    
42476946 --tggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 472 - 606
Target Start/End: Original strand, 7879644 - 7879773
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccg 570  Q
    ||||||| |||||||| |||||  ||||||||||||||| || ||||    |||||||||| |||||||||||  ||||||||||||||||||||||| |    
7879644 cacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctg 7879737  T
571 catatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | ||||||||||||| |||||||| |||||||||||    
7879738 cgtatgcgggagcttcagtgcaccgggttgcccttt 7879773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 19427046 - 19426890
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||| |||| | ||||||| |||||||| ||||| | ||||||||||||||     ||||| ||| ||||||| ||||||||||    
19427046 taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaa----tagggtaagactgcgtacaatacaccaa 19426951  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||| ||| ||||||| ||||||||| |||||| |||||||| |||||||||||    
19426950 a--tggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcccttt 19426890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 519 - 607
Target Start/End: Complemental strand, 45019012 - 45018922
Alignment:
519 ggaaggctgcgtaaaatacaccaaaaa--tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    ||||||||||||| |||| ||||||||  |||||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||    
45019012 ggaaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttg 45018922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 433 - 605
Target Start/End: Complemental strand, 3469347 - 3469176
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa---cagggtagggaaggctgcg 529  Q
    |||||||| | ||||||||||||||||||||||||| | ||| |   ||||||||||||||  |||||||||||||||   ||||||| ||     ||||    
3469347 tggcgcaacggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggt----tgcg 3469252  T
530 taaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    || |||||||||||||||| ||||||||||||  ||||| |  ||||||||||||||||||| |  ||||||||||    
3469251 tacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt 3469176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 433 - 586
Target Start/End: Complemental strand, 28362313 - 28362165
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||| | |||||||||||||||||| |||||| | ||| ||| |||||||||||||| | ||||||||||||||     | || |||||||||||     
28362313 tggcgcaacggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaa---acttggtaaggctgcgtac 28362217  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||||  |||||||||||||||||||| ||||  ||||||| |||||||||    
28362216 aatacacc--aaatggtgggaccccttcccagaccttgcatatgtgggagcttt 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 47078010 - 47077867
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| ||||||||||| |||| || ||    || | |||||| |||||||  ||    
47078010 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgt-aaaatagagt----aaagttgcgtacaatacac--aa 47077918  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||||||||  ||||  |||||||||||||| |||||||||    
47077917 aatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcacc 47077867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 518 - 606
Target Start/End: Complemental strand, 27889402 - 27889316
Alignment:
518 gggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||| |||||||||||  ||||||||||||||||||||||| || |||||||||||||| || |||| |||||||||||    
27889402 gggaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttt 27889316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 433 - 586
Target Start/End: Original strand, 13805069 - 13805216
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||||| ||||||||||||||||||||||||| |  |||||| |||||||| ||||  | |||| |||| ||||||||   || ||||||| |||     
13805069 tggcgcaatggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgt-aaaacagg---ggtaaggctgtgtac 13805164  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||||  ||||||||||||| ||||| |||||| || ||||||||||||||    
13805165 aatacacc--aaatggtgggaccacttcctggaccctgcgtatgcgggagcttt 13805216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 444 - 604
Target Start/End: Complemental strand, 35334971 - 35334818
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | |||| || |||||||| ||||| ||||| |||  ||||||||||||    || ||| ||| |||||||| ||    
35334971 taaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctcgtgta-aaaaacagggta----agactgtgtacaatacaccgaa 35334877  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
      ||||||||||||||||||||||| || ||||| |||||||||||||||| |||| ||||    
35334876 --tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct 35334818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 444 - 614
Target Start/End: Complemental strand, 14732979 - 14732813
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || |||| |||||||| ||||| | |||   |||||||| |||||||    ||||||||| || ||||||||    
14732979 taaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggta----aggctgcgtcaa-tacaccaa 14732885  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttattc 614  Q
    ||||||||  || |||||||| |||| |  |||||||||||||||||||||| | ||| ||||||| |||||    
14732884 aaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtcctttgtctattc 14732813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 31591192 - 31591109
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| ||||||  | |||||||||||||||||||||||||  ||||||||||||||| ||||||||| |||||||||||    
31591192 aaggctgcgtacaataca--ataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgcccttt 31591109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 444 - 605
Target Start/End: Original strand, 16341256 - 16341413
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||| ||||||   ||||| | ||||||| ||||| |||||||| | |||||||||||||| |||||||    ||||| |||| ||||||||||    
16341256 taaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggta----aggctacgtacaatacaccaa 16341351  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    || ||||||| || |||||||||||   |||||||||||||||| ||||||| || |||||||    
16341352 aa-tggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgccctt 16341413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 446 - 587
Target Start/End: Complemental strand, 28078286 - 28078151
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa 545  Q
    |||||||||||||||||||| || | ||||||| |||||||||||||| ||||| |||  |||||||||||    |||| ||| |  ||||||||  |||    
28078286 aagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggt----aaggttgcatgcaatacacc--aaa 28078193  T
546 tggtgggaccccttcccggaccccgcatatgcgggagcttta 587  Q
    |||||||||||||||||| | || ||||||||| ||||||||    
28078192 tggtgggaccccttcccgaatcctgcatatgcgagagcttta 28078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 445 - 605
Target Start/End: Original strand, 11741774 - 11741927
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    |||||||||||||||||||||||| | || |||| ||||||||  |||| |  ||| ||||||||  ||||||    |||||||||| |||||||||||     
11741774 aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaat-agggta----aggctgcgtacaatacaccaaa- 11741867  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
     |||||||| |||||||||||  | ||| ||||||||||| ||||||||| ||||||||||    
11741868 -tggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt 11741927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 472 - 604
Target Start/End: Complemental strand, 18512581 - 18512455
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgc 571  Q
    ||||||| |||||||| |||||    ||||||||||||| ||||||    |||||||||| |||||||| ||  ||||||||||||||||||||||| ||    
18512581 cacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggta----aggctgcgtacaatacaccgaa--tggtgggaccccttcccggaccctgc 18512488  T
572 atatgcgggagctttagtgcaccaggttgccct 604  Q
     |||||||||||||| ||||||  |||||||||    
18512487 gtatgcgggagctttggtgcactgggttgccct 18512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 519 - 594
Target Start/End: Original strand, 21566485 - 21566559
Alignment:
519 ggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||| ||||||| |||||||||||| |||| ||||||||||||| |||| |||||||||||||||||||||||||    
21566485 ggaagactgcgtacaatacaccaaaa-tggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcacc 21566559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 452 - 605
Target Start/End: Original strand, 18747472 - 18747621
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacaccaaaaatggt 549  Q
    |||||| |||||||||| | ||||||  |||||| | ||||| | || |||||||||||  ||||||    ||||||||||| ||||||||  || ||||    
18747472 ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggt----aaggctgcgtataatacacc--aattggt 18747565  T
550 gggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||| | |||| || |||||||||||||||||||||| || |||||||    
18747566 gggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 433 - 606
Target Start/End: Complemental strand, 23419842 - 23419674
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||| |||||||||||| ||| | ||| ||| ||||| || ||||| | |||||||||| ||||||||||    ||| |||||||    
23419842 tggcgcaacggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggt----aagactgcgta 23419747  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||  |||||||||||||||||||  ||||  || | |||||| ||||||||||| | || ||||||||    
23419746 caatacacc--aaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttt 23419674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 449 - 611
Target Start/End: Complemental strand, 32233286 - 32233130
Alignment:
449 ttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatgg 548  Q
    |||||||||  ||||||||| | || |||| |||||||| |||||   |||||||||||||||||||||    |||| ||||| | |||||||||  |||    
32233286 ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggta----aggcagcgtatattacaccaaa--tgg 32233193  T
549 tgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||  |||||||  |||| ||||||| |||||||| |||||||| || |||||||| ||||    
32233192 tgggattccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgcccttttttta 32233130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 497 - 587
Target Start/End: Original strand, 38604558 - 38604642
Alignment:
497 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttta 587  Q
    |||||||||||||||||||||    |||||||||| |||||||||||  ||||| |||||||| |||||||| || |||||||||||||||    
38604558 ctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgagacccctttccggaccctgcgtatgcgggagcttta 38604642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 497 - 606
Target Start/End: Complemental strand, 35787372 - 35787269
Alignment:
497 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccag 596  Q
    |||||||||||||||| ||||    ||| |||||| |||||||||||  ||| ||||||||||||||||||  || ||||||||||||| | |||||| |    
35787372 ctcttgtgtaaaaacatggta----aggttgcgtacaatacaccaaa--tggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg 35787279  T
597 gttgcccttt 606  Q
    ||||||||||    
35787278 gttgcccttt 35787269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 517
Target Start/End: Complemental strand, 42495992 - 42495919
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    ||||||||||||||| ||||||||| | ||||||| |||||||| ||||| | ||||||| |||||||||||||    
42495992 taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggta 42495919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 444 - 585
Target Start/End: Original strand, 19266428 - 19266564
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | |  |||| ||||||||  |||  | | |||| ||||||| |||||||    |||||||||| ||||||||||    
19266428 taaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggta----aggctgcgtacaatacaccaa 19266523  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctt 585  Q
    |  | |||||| |||||||||||||| || |||||||||||||    
19266524 a--ttgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 525 - 591
Target Start/End: Original strand, 33500569 - 33500635
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc 591  Q
    |||||||  |||||| |||||||||||||||||||||||||||| || ||||||||| ||| |||||    
33500569 ctgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc 33500635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 457 - 606
Target Start/End: Complemental strand, 38262340 - 38262196
Alignment:
457 atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaaaaatggtgggacc 555  Q
    ||||||||| || | ||||||| |||||||| ||||| ||||||||||||||||     || || || | ||| || |||||||||||  || |||||||    
38262340 atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaa----tatggtaatgttgcatacaatacaccaaa--tgatgggacc 38262247  T
556 ccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| || | || |||||||||||||||||||||| | |||||||||    
38262246 ccttcccgaacactgcgtatgcgggagctttagtgcaccggattgcccttt 38262196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 433 - 582
Target Start/End: Complemental strand, 48123652 - 48123508
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa-aacagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||| ||||||| |||||| | || |||| |||||||| ||||| | |||||||||||| ||||||||    ||  |||| ||    
48123652 tggcgcaacggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggt----aaaactgcata 48123557  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggag 582  Q
     ||||||||  ||||||||||||||||| | |||||  |||||||||||||    
48123556 caatacacc--aaatggtgggacccctttctggaccatgcatatgcgggag 48123508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 444 - 517
Target Start/End: Original strand, 18327012 - 18327085
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||||||||||||||||  || | ||||||| |||||||  ||||| | |||||||||||||||||||||    
18327012 taaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggta 18327085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 444 - 508
Target Start/End: Original strand, 7193063 - 7193127
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa 508  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| |||||   ||||||||||||    
7193063 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa 7193127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 594
Target Start/End: Original strand, 23231609 - 23231680
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||| ||  || ||||||||||||||| |||| || ||||||| ||||||||||||||    
23231609 aaggctgcgtataatacaccgaa--tgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc 23231680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 433 - 510
Target Start/End: Original strand, 7644923 - 7645000
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    ||||||| || |||| ||||||| | |||||||||| | ||||||| |||||||| ||||| | ||||||||||||||    
7644923 tggcgcagtggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa 7645000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 555 - 603
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    |||||||||||||| || ||||||||||||||||||||||  |||||||    
42495913 cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc 42495865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 559
Target Start/End: Complemental strand, 5180314 - 5180202
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || |||| ||| | || ||||| | ||||||||| |||||||||||    ||| ||| ||| || |||||||    
5180314 taaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggt----aagactgtgtacaacacaccaa 5180219  T
543 aaatggtgggacccctt 559  Q
    ||||| | |||||||||    
5180218 aaatgattggacccctt 5180202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 472 - 587
Target Start/End: Original strand, 35203445 - 35203557
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccg 570  Q
    ||||||| |||||||| |||||  ||||||||||||||| |||| ||    || ||||||| |||| |||||||||||||||| ||||||| | || |      
35203445 cacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggata----agactgcgtacaatataccaaaaatggtgggatcccttcctgaactcta 35203540  T
571 catatgcgggagcttta 587  Q
    | |||||||||||||||    
35203541 cgtatgcgggagcttta 35203557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 559 - 606
Target Start/End: Original strand, 36602535 - 36602582
Alignment:
559 tcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||| ||||| || |||||||||||||||||||||| |||||||||||    
36602535 tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 36602582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 444 - 510
Target Start/End: Complemental strand, 7794663 - 7794597
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||| ||||||||| || | ||||||| |||||||| ||||| | ||||| ||||||||    
7794663 taaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaa 7794597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 517
Target Start/End: Original strand, 6736868 - 6736941
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||||||||||| |||||||| | ||||||| ||||||||  ||||   ||||||| |||||||| ||||    
6736868 taaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggta 6736941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 517
Target Start/End: Complemental strand, 44123778 - 44123705
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||| ||||||||||||||||    |||||| ||||| || ||||| | |||||||||||||||| ||||    
44123778 taaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgtaaaaacaaggta 44123705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 534 - 606
Target Start/End: Complemental strand, 23987455 - 23987383
Alignment:
534 atacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||| |||||||||  | ||||| || ||| || ||| |||||||||||| |||| |||||    
23987455 atacaccaaaaatggtaggaccccttttcagaccctgcgtatacgagagttttagtgcaccaagttgtccttt 23987383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 108; Significance: 6e-54; HSPs: 67)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 6e-54
Query Start/End: Original strand, 433 - 607
Target Start/End: Original strand, 10543664 - 10543836
Alignment:
433 tggcgcaa-tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgt 530  Q
    |||||||| |||||||||||||||||||||||||||| | ||||||| |||||||| ||||||| |||||||||||||| |||||||    |||||||||    
10543664 tggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggta----aggctgcgt 10543759  T
531 aaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    | |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||    
10543760 acaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttg 10543836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 6e-42
Query Start/End: Original strand, 439 - 606
Target Start/End: Original strand, 5841001 - 5841165
Alignment:
439 aatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatac 537  Q
    ||||||||||||||||||||||||||| || | ||||||| |||||||||||||| | || |||||||||||     ||||| |||| |||||| |||||    
5841001 aatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaa----tagggtaaggatgcgtacaatac 5841096  T
538 accaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
5841097 atcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 5841165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 14530296 - 14530455
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| |||||||    ||||| |||| ||||||||||    
14530296 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctacgtacaatacaccaa 14530391  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
14530392 taatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 14530455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 24200782 - 24200623
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
24200782 taaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 24200687  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||||| |  |||| | ||||||||||||||| |||||||||||    
24200686 aaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgcccttt 24200623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 8455473 - 8455316
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | ||||||||||||| ||||||||    |||||||||| ||||||||||    
8455473 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggta----aggctgcgtacaatacaccaa 8455378  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || ||||| |||||||||||||||| |||||||||||    
8455377 a--tggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcccttt 8455316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 446 - 606
Target Start/End: Complemental strand, 21779414 - 21779261
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa 545  Q
    ||||||||||||||||||||||| | ||||||| |||||||| || || | ||||||||||||| |||||||    ||| |||||| |||||||||||      
21779414 aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaa-cagggta----aggttgcgtacaatacaccaaa-- 21779322  T
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
21779321 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 21779261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 9671158 - 9671314
Alignment:
444 taaagttgttgtcatgtgactg-aaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| ||| | ||||||| ||| |||| ||||| | ||||||||||||| |||||||    |||||||||| ||||||||||    
9671158 taaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaa 9671252  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
9671253 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 9671314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 25249894 - 25249738
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||| | ||||| |||||||||||| |||||||||    ||||||||||| ||||||||  |    
25249894 taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggt----aaggctgcgtacaatacacc--a 25249801  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||| ||||||||| |||| || |||||| ||||||||||||||| |||||||||||    
25249800 aatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttt 25249738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 457 - 606
Target Start/End: Original strand, 14444720 - 14444863
Alignment:
457 atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc 556  Q
    ||||||||| || | ||||||| |||||||| ||||| | |||||||||||||||||||||    |||||| |||  ||||||||||  |||||||||||    
14444720 atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggctgtgtacgatacaccaaa--tggtgggaccc 14444813  T
557 cttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||    
14444814 cttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt 14444863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 444 - 602
Target Start/End: Original strand, 7214512 - 7214667
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || |||| |||||| | ||||| ||||||||||||||| ||||||||    |||||||||| ||||||| ||    
7214512 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggta----aggctgcgtacaatacacaaa 7214607  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    |||||||| || |||||| ||||| | || |||||| ||| |||||||||||||||||||    
7214608 aaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcc 7214667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 12024075 - 12023931
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||||||||||    ||||||||||| ||||||||  |    
12024075 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a 12023982  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||| |||||||||| || |||  || ||||||| ||||||    
12023981 aatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcacc 12023931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 23397744 - 23397899
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | || |||| |||||||| ||||| | |||||||||||||  ||||||    ||||| |||| |||||||||||    
23397744 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaat-agggta----aggctacgtacaatacaccaaa 23397838  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||| |||||||  |||||||||||||| ||||||||| |||||||||||    
23397839 --tggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt 23397899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 457 - 611
Target Start/End: Original strand, 10546153 - 10546303
Alignment:
457 atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac 554  Q
    |||||||||||| | ||||||| |||||||| |||||   ||||||| ||||||  |||||||    |||||||||| |||||||||||  |||||||||    
10546153 atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggac 10546246  T
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||||||||||| || |||||||||||||||||||||| ||||||||||| ||||    
10546247 cccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttta 10546303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 444 - 609
Target Start/End: Complemental strand, 25079875 - 25079714
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||| |||||||   |||||||||||||| |    ||| |||| |||||| |||||||| ||    
25079875 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaaca--aggtaaggatgcgtacaatacaccgaa 25079778  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtt 609  Q
      ||||||||||||||||||||||| || |||||  ||||||||||||||| ||||||||||||||    
25079777 --tggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgccctttgtt 25079714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 17896237 - 17896395
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||| |||| | ||||| | ||||||||||||||   |||||||||||||| |   ||||| ||||||||||| |||| |||||    
17896237 taaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaa---tagggtaaggctgcgtacaatataccaa 17896333  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||| ||||||| || |||| ||||||||||||||| |  ||||||||||    
17896334 a--tggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttt 17896395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 482 - 611
Target Start/End: Original strand, 36871509 - 36871631
Alignment:
482 agtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcggga 581  Q
    |||||| ||||| | ||||||||| |||||||||||    |||||||||| |||||||||||  ||||||||||||||||||||||  || |||||||||    
36871509 agtcctggaaacagcctcttgtgtgaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggacct-gcgtatgcggga 36871601  T
582 gctttagtgcaccaggttgccctttgttta 611  Q
    ||||||||||||| ||||||||||| ||||    
36871602 gctttagtgcaccgggttgcccttttttta 36871631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 14544041 - 14544201
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta--aaaacagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||||||||||||||| |  || |||||| || || ||||| | ||||||||||  |||||||||||    || ||||||  ||||  | |    
14544041 taaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggta----agactgcgtgcaataaccaa 14544136  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| ||||||||||| |||||| || ||||||||||||||||||||||| ||||||||||    
14544137 aaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt 14544201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 11514414 - 11514570
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| ||| |||| ||||| | |||||||||||||| ||  |||    |||||||||| ||||||||||    
11514414 taaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagta----aggctgcgtacaatacaccaa 11514509  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||| ||||| ||||| || |||||||||||||||||||||| | |||||||||    
11514510 a--tggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttt 11514570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 17667980 - 17668137
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||    |||||||||||||| |||||||    |||||||||| ||||||||||    
17667980 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggta----aggctgcgtacaatacaccaa 17668075  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||| |||||||| || |||| || |||  ||||||||||||||||| |||||||||||    
17668076 a--tggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcccttt 17668137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 17623542 - 17623699
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||| ||||| || | ||||||| |||||||| |||||   |||||||||||||| ||||||    ||||||||||| ||||||||      
17623542 taaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggt----aaggctgcgtacaatacacc-- 17623635  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| ||||||||||| | || || |||| || |||||||||||||  |||||||||||    
17623636 aaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcccttt 17623699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 444 - 568
Target Start/End: Original strand, 22371035 - 22371151
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||  | | ||||||| |||||||| ||||| | |||  |||||||||||||||    ||||||||||| ||||||||  |    
22371035 taaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctc--gtgtaaaaacagggt----aaggctgcgtacaatacacc--a 22371126  T
544 aatggtgggaccccttcccggaccc 568  Q
    |||||||||||||||||||||||||    
22371127 aatggtgggaccccttcccggaccc 22371151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 533 - 606
Target Start/End: Original strand, 23488545 - 23488618
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| |||||||||||||||||||||||||||| || |||||| ||||||||||||||| |||||| ||||    
23488545 aatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctcttt 23488618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 546 - 606
Target Start/End: Original strand, 34080176 - 34080236
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||    
34080176 tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcccttt 34080236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 552 - 607
Target Start/End: Complemental strand, 3633762 - 3633707
Alignment:
552 gaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
3633762 gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttg 3633707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 545 - 604
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    |||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||    
41409936 atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct 41409995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 444 - 590
Target Start/End: Complemental strand, 99420 - 99281
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||| |||||||||| | ||||||| |||||||||||||| | |||||||  |||||||     || ||||||||||| ||||||||  |    
99420 taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgt-aaaaaaca----tggcaaggctgcgtacaatacacc--a 99328  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 590  Q
    |||||||| |||||||| | ||||| |  ||||||||||||||||||    
99327 aatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 31158598 - 31158451
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || ||||  ||||| |  |||| | |||||| ||||||| |||||||    ||  ||| || |||| |||||    
31158598 taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggta----agattgcatacaataaaccaa 31158503  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||||||||| ||||| || ||||||||||||||||| ||||    
31158502 aaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc 31158451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 545 - 605
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||||||||||||||| |  |||||||||||||||||||||| ||||||||||    
40579810 atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 433 - 606
Target Start/End: Original strand, 44643489 - 44643658
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgt 530  Q
    |||||||||| |||||||||  |||||||||||||| | |||| || ||||| |||||||  | |||||  |||||||  ||| |||    |||||||||    
44643489 tggcgcaatggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagta----aggctgcgt 44643584  T
531 aaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | |||  ||||||  ||||||||||||||||| ||||| || ||||||||||| |||||||||| || ||||||||    
44643585 acaatgtaccaaa--tggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgcccttt 44643658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 433 - 603
Target Start/End: Complemental strand, 4516519 - 4516354
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||||||| |||||||||| | |||   | ||||| |||||||| | |||||||||||||| ||||| |    | ||||||||    
4516519 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggca----acgctgcgta 4516424  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
     ||||||||||   ||||||||||||||||||||||| || |||| || |||||||||| ||| || |||||    
4516423 caatacaccaat--tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc 4516354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 551 - 606
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||| || |||| |||||||||||||||||||||||||||||    
8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt 8576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 444 - 586
Target Start/End: Complemental strand, 21377230 - 21377093
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| |  ||| || |||||| |||||||   |||||||||| ||||||||||    ||||||| ||| ||| ||||      
21377230 taaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggt----aaggctgggtacaatgcacc-- 21377137  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||||||||||||||||| |||| || |||| |||||||||    
21377136 aaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt 21377093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 521 - 607
Target Start/End: Complemental strand, 40762317 - 40762233
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||| |||| |||||||||||  ||||||||||| |||| |||||| || |||| ||||||||||||||||| ||||||||||||    
40762317 aaggctacgtacaatacaccaaa--tggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgccctttg 40762233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 444 - 603
Target Start/End: Complemental strand, 45235975 - 45235820
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||| ||||||||||||||   |||| || |||||||||||||| ||||||| |||||||  |   ||||| |||||| |||  |||||||  |    
45235975 taaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataa---tagggtaaggctacgtgtaatacac--a 45235881  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    ||||||||||||||||| || |||||  | ||||| |||||||||||| |||| |||||||    
45235880 aaatggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc 45235820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 446 - 606
Target Start/End: Complemental strand, 19977869 - 19977714
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaaaa 544  Q
    |||||||||||||||||| |||| | ||||||| ||||| || ||||| | ||||| ||||||||     ||||  |||| |||||| |||||||||||     
19977869 aagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaa----taggataaggttgcgtacaatacaccaaa- 19977775  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||| ||||||||| |||  |  |||||||||||||||||||||||| || ||||||    
19977774 -tggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagattacccttt 19977714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 451 - 612
Target Start/End: Original strand, 25641487 - 25641642
Alignment:
451 gttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtg 550  Q
    |||||||||||||||||| | ||||||| |||||||| ||||| |  | |||||| ||||||||||    || | |||||| ||||||||  |||| |||    
25641487 gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggt----aaagttgcgtacaatacacc--aaattgtg 25641580  T
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttat 612  Q
    ||||||||||||| | || || |||||| ||||||||||| ||| | ||| ||||| |||||    
25641581 ggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtcctttttttat 25641642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 544
Target Start/End: Complemental strand, 29420046 - 29419945
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||  ||||||||| | |||| || |||||||| |||||   |||||||||||||| ||||||| | ||||||||||| ||||||||||    
29420046 taaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacaccaa 29419947  T
543 aa 544  Q
    ||    
29419946 aa 29419945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 39914463 - 39914306
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    |||||||||||||||||||||| || | ||||||  ||||| || |||||   ||||||||||||||  ||||||| |||    || ||| ||||||||     
39914463 taaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaagga----tgtgtacaatacaccg 39914368  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||  |||||||||||||||| | |||| || |||||||||||||||||||| | |||||||||||    
39914367 aa--tggtgggaccccttcctg-accctgcgtatgcgggagctttagtgcatcgggttgcccttt 39914306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 455 - 595
Target Start/End: Original strand, 19614981 - 19615117
Alignment:
455 tcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtggga 553  Q
    |||||||||||||| | ||||||| |||||||| |||||   ||||||| |||||| |||||||    || ||||||| |||| ||||| ||| |||| |    
19614981 tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggta----agactgcgtacaatataccaataatagtgg-a 19615075  T
554 ccccttcccggaccccgcatatgcgggagctttagtgcacca 595  Q
    |||||||||| |||| || ||||| |||||||||||||||||    
19615076 ccccttcccgaaccctgcgtatgcaggagctttagtgcacca 19615117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 546 - 606
Target Start/End: Original strand, 34766330 - 34766390
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| || |||||||||||||||||||| | |||| ||||||    
34766330 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttt 34766390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 444 - 568
Target Start/End: Original strand, 5450263 - 5450383
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||||||||||||||| | ||||||| ||| |||| |||||   ||||||||||||||  || ||||    |||||||||| ||||||||     
5450263 taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggta----aggctgcgtacaatacacc- 5450357  T
542 aaaatggtgggaccccttcccggaccc 568  Q
     ||| ||||||||||||||| ||||||    
5450358 -aaagggtgggaccccttcctggaccc 5450383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 433 - 616
Target Start/End: Complemental strand, 17380404 - 17380228
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    ||||||||||   |||||||||||||||||| |||| | ||||||| |||||| | |||||   |||||||||| |||||||||    |||| || ||      
17380404 tggcgcaatggcgaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggt----aaggttgtgtgc 17380309  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttattcat 616  Q
    ||||||||  ||||| ||| ||||||||| |||||| ||  ||||||||||||| ||||||| || | |||||| |||||||||    
17380308 aatacacc--aaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccgggcttccctttatttattcat 17380228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 24860143 - 24860000
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||| ||||||||||||||||| || |  ||||||  ||| ||| |||||   |||| ||||||||||| |||     |||||||||| ||||||||  |    
24860143 taaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggt-----aggctgcgtacaatacacc--a 24860051  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||| | |||||||| ||||||| || ||||||||||||||||||||||    
24860050 aatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcacc 24860000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 521 - 607
Target Start/End: Original strand, 25632561 - 25632645
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    ||||||||||| |||||||||||  ||||||||  |||||||| |||   | |||||||||||||||||||||| ||||||||||||    
25632561 aaggctgcgtacaatacaccaaa--tggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctttg 25632645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 555 - 602
Target Start/End: Complemental strand, 39189555 - 39189508
Alignment:
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||    
39189555 cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcc 39189508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 40417028 - 40416871
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||| | |||||   ||||||| |||||| ||||| |    |||||| ||| ||||||||||    
40417028 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaa----aggctgtgtacaatacaccaa 40416933  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
       || |||||||| ||   |||||| ||||||||| ||||||||||||||| |||||||||||    
40416932 t--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcccttt 40416871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 543 - 605
Target Start/End: Complemental strand, 13245158 - 13245096
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||||||||||||||||  |||||| |||||||||||||| | | ||||||||||    
13245158 aaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 27573599 - 27573755
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||  ||| |||||||  | ||| | |||||||||| ||||| |||    ||||||||||| ||||||||  |    
27573599 taaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggt----aaggctgcgtacaatacacc--a 27573692  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| |||  |||||  |||| |  |||| ||||||||||||||| | |||||||||||    
27573693 aatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgcccttt 27573755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 593
Target Start/End: Original strand, 24890463 - 24890533
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    |||||||| || ||||||||||   ||||||||||||||||||||||| || ||||| |||||||||||||||    
24890463 aaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 497 - 606
Target Start/End: Original strand, 30826068 - 30826170
Alignment:
497 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccag 596  Q
    |||||||||||||| ||||||    ||| |||||| |||||||||||  |||||| |||| ||||| |||||  ||||||||||||||||||||||||||    
30826068 ctcttgtgtaaaaatagggta----aggttgcgtacaatacaccaaa--tggtggaaccc-ttcccagaccctacatatgcgggagctttagtgcaccag 30826160  T
597 gttgcccttt 606  Q
     ||| |||||    
30826161 attgtccttt 30826170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 433 - 597
Target Start/End: Complemental strand, 32781456 - 32781298
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta 531  Q
    |||||||||| |||||||||||  ||||  |||||| | |||| || ||||||   |||||   |||||||||||||| |||||||    || |||||||    
32781456 tggcgcaatggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggta----agactgcgta 32781361  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccagg 597  Q
     |||||||||||  ||||||||||||||||| ||||| |  |||||||||||||| ||||||||||    
32781360 caatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcgggagcttt-gtgcaccagg 32781298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 444 - 517
Target Start/End: Original strand, 44604832 - 44604905
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||||||||||||||||| || | ||| ||| |||||||| |||||   |||||||||||||||||||||    
44604832 taaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggta 44604905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 558 - 606
Target Start/End: Original strand, 22371199 - 22371247
Alignment:
558 ttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| || |||||||||||||||||||||| |||||||||||    
22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 22371247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 544 - 606
Target Start/End: Original strand, 1289095 - 1289158
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||| |  |||||||||||||| ||||||||||| | |||||||||    
1289095 aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgcccttt 1289158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 526 - 589
Target Start/End: Complemental strand, 19185823 - 19185760
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagt 589  Q
    |||||| ||| ||| ||||||||||| ||||||||| |||||| || |||||||||||||||||    
19185823 tgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagt 19185760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 543 - 593
Target Start/End: Original strand, 4794874 - 4794924
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    ||||| ||||||||||||||||| || ||||||||||||||| ||||||||    
4794874 aaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac 4794924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 558 - 607
Target Start/End: Complemental strand, 124962 - 124913
Alignment:
558 ttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    ||||||||||| || |||||||||||||||||||||| ||||||| ||||    
124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccttttg 124913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 444 - 586
Target Start/End: Original strand, 33795263 - 33795400
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta-aaatacacca 541  Q
    |||||||||||||| |||| ||||| | ||||||| |||||||  |||||   |||||| ||||||| |||||||    |||||||||| |||||||||     
33795263 taaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggta----aggctgcgtacaaatacacct 33795358  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    |   ||||||||||||||||| ||||| |  ||||||||||||||    
33795359 a---tggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 521 - 594
Target Start/End: Complemental strand, 44449467 - 44449395
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||||||| | ||||||||||||||||||||| || | || ||||| |||| ||||||    
44449467 aaggctgcgtacaatacaccaaaa-tagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc 44449395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 444 - 508
Target Start/End: Original strand, 17705473 - 17705537
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa 508  Q
    |||||||||||||||||||||  || | ||||||| |||||||| ||||| | ||||||||||||    
17705473 taaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaa 17705537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 594
Target Start/End: Complemental strand, 26684683 - 26684632
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||||| ||||||| |||| || ||||||||||||||| ||||||    
26684683 aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcacc 26684632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 543 - 593
Target Start/End: Original strand, 31523303 - 31523353
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    ||||||||| |||| |||||  |||| ||||||||||||||||||||||||    
31523303 aaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcac 31523353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 525 - 594
Target Start/End: Original strand, 17471605 - 17471673
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||| |||| ||||||| || || ||||||||||| ||||| || |||||||||| |||||||||||    
17471605 ctgcgtacaatataccaaaa-tgatgagaccccttccctgaccctgcctatgcgggagttttagtgcacc 17471673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 568
Target Start/End: Complemental strand, 23145855 - 23145736
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||   |||||||||| | ||||||| |||||| |  |||| | |||||||||||||| ||| |||    |||||||||| ||||||||||    
23145855 taaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgta----aggctgcgtacaatacaccaa 23145760  T
543 aaatggtgggaccccttcccggaccc 568  Q
       ||||||||||| |||||||||||    
23145759 t--tggtgggaccctttcccggaccc 23145736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 568
Target Start/End: Complemental strand, 23557645 - 23557526
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||   |||||||||| | ||||||| |||||| |  |||| | |||||||||||||| ||| |||    |||||||||| ||||||||||    
23557645 taaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgta----aggctgcgtacaatacaccaa 23557550  T
543 aaatggtgggaccccttcccggaccc 568  Q
       ||||||||||| |||||||||||    
23557549 t--tggtgggaccctttcccggaccc 23557526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 545 - 590
Target Start/End: Complemental strand, 24059057 - 24059012
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtg 590  Q
    ||||||||||||||| |||||||| || |||| |||||||||||||    
24059057 atggtgggacccctttccggaccctgcgtatgtgggagctttagtg 24059012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 603
Target Start/End: Original strand, 31525778 - 31525838
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    ||||| |||||||| || || ||||| ||||||||||||||||||||| ||| | ||||||    
31525778 aaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc 31525838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 98; Significance: 6e-48; HSPs: 39)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 526 - 643
Target Start/End: Original strand, 12892064 - 12892181
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttattcatgaaaaggct 625  Q
    |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||    
12892064 tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttttattaatgaaaaggct 12892163  T
626 tcgtctcattcttctcat 643  Q
    ||||||||||||||||||    
12892164 tcgtctcattcttctcat 12892181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 449 - 606
Target Start/End: Complemental strand, 29356009 - 29355855
Alignment:
449 ttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaaaatg 547  Q
    |||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||| ||||||||||    |||||||||| |||||||||| ||||    
29356009 ttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggta----aggctgcgtacaatacaccaataatg 29355914  T
548 gtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
29355913 gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 29355855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 86; E-Value: 9e-41
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 9161101 - 9161259
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||||||| |||    |||||||||| |||||| |||     
9161101 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagta----aggctgcgtacaatacatcaat 9161196  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||| ||||||| || ||||||| ||||||||||||||||||||||||||    
9161197 aatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgcccttt 9161259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 12222074 - 12221914
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||| | ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
12222074 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 12221979  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || ||||||||||| ||||||||||| |||||||||||    
12221978 taatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt 12221914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 1346942 - 1347097
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | | ||||||||||| |||||||    |||||||||| |||||||||||    
1346942 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 1347036  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
1347037 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1347097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 1354912 - 1354757
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
1354912 taaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 1354818  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
1354817 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1354757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 2166569 - 2166410
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||| |||||||||||| | ||||||| |||||||| |||||   ||||||||||||| ||||| ||    ||| |||||| ||||||||||    
2166569 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggata----aggttgcgtacaatacaccaa 2166474  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||||||||||||||||||||   |||| |||||||||||||||||| |||||||||||    
2166473 taatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt 2166410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 2178202 - 2178043
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||| |||||||||||| | ||||||| |||||||| |||||   ||||||||||||| ||||| ||    ||| |||||| ||||||||||    
2178202 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggata----aggttgcgtacaatacaccaa 2178107  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||||||||||||||||||||   |||| |||||||||||||||||| |||||||||||    
2178106 taatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttt 2178043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 533 - 607
Target Start/End: Complemental strand, 14975163 - 14975089
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||| ||||    
14975163 aatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgccgtttg 14975089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 525 - 606
Target Start/End: Original strand, 12885967 - 12886048
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| ||||||| |||||||||||||||||||||| ||||| || |||| ||||||||||||||||| |||||||||||    
12885967 ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgcccttt 12886048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 26097210 - 26097293
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||  ||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
26097210 aaggctgcgtacaatacaccaaa--tgaagggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 26097293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 444 - 574
Target Start/End: Original strand, 6024211 - 6024338
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||| || || | ||||| | ||| |||||||||| | |||||||||||||| || ||||    || ||||||| ||||||||||    
6024211 taaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggta----agactgcgtacaatacaccaa 6024306  T
543 aaatggtgggaccccttcccggaccccgcata 574  Q
     |||| ||||||| ||||||||||||||||||    
6024307 taatgatgggacctcttcccggaccccgcata 6024338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 544 - 606
Target Start/End: Original strand, 6808468 - 6808530
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| |  |||||||||||||||||||||| |||||||||||    
6808468 aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 6808530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 25557775 - 25557858
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||  || |||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
25557775 aaggctgcgtacaatacaccaaa--tgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 25557858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 533 - 606
Target Start/End: Complemental strand, 3116202 - 3116129
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||||| ||||||  || ||||||||||||||||| |||| | |||||||||    
3116202 aatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttt 3116129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 444 - 599
Target Start/End: Complemental strand, 3815234 - 3815084
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta-gggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | || |||||||||||     || || | | ||||||| ||||||||      
3815234 taaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaa----atatggtacgactgcgtacaatacacc-- 3815141  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggtt 599  Q
    |||||||||||||| |||||| ||||  | ||||||| |||||||||||||| ||||    
3815140 aaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt 3815084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 606
Target Start/End: Original strand, 17432332 - 17432483
Alignment:
458 tgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtaggg--aaggctgcgtaaaatacaccaaaaatggtgggac 554  Q
    ||||||||||| | ||| ||| |||||||| |||||    ||||||||||||| ||||||| ||  ||||||| ||| ||||||| |||||||||| |||    
17432332 tgtgactgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagac 17432431  T
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||||| || |   ||||||||||||||||||||| |||||||||||    
17432432 cttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt 17432483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 13267797 - 13267860
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||| |||||| || ||||||||||||| |||||||| |||||||||||    
13267797 aaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt 13267860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 24097649 - 24097712
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||| || ||||||| ||||||||||  ||||||||||||||    
24097649 aaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgcccttt 24097712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 7947455 - 7947371
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||| ||||||| ||||||||||||||  || |||| ||||||||||||||||  || ||||||||    
7947455 aaggctgcgtacaatacaccaaaa-tggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcacttggctgcccttt 7947371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 545 - 606
Target Start/End: Complemental strand, 23930188 - 23930127
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||| ||||||| || ||||||||||||||||||||||  ||||||||||    
23930188 atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttt 23930127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 551 - 611
Target Start/End: Complemental strand, 20906841 - 20906781
Alignment:
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||||||||| ||||||||||||||||||||||||||| |||| ||||| |||| ||||    
20906841 ggaccccttcccagaccccgcatatgcgggagctttagtgaaccaagttgctcttttttta 20906781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 543 - 599
Target Start/End: Original strand, 32579497 - 32579553
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggtt 599  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||| | |||||||    
32579497 aaatggtgggaccccttcccagaccctgcatatgcgggagctttagtactccaggtt 32579553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 521 - 605
Target Start/End: Complemental strand, 2755507 - 2755422
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatat--gcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||||||| |||||||||||||||||||||  |||||||  | || ||||||  ||||||||||||||||||| ||||||||||    
2755507 aaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt 2755422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 433 - 510
Target Start/End: Complemental strand, 13905147 - 13905070
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||| | ||||||||||||||||||||||||| | ||||||  ||||||||  |||||  ||||||||||||||    
13905147 tggcgcaacggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaa 13905070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 546 - 606
Target Start/End: Complemental strand, 10734965 - 10734905
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| ||||||||||||||| || ||||||||||||||||| |||| || ||||||||    
10734965 tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt 10734905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 510
Target Start/End: Original strand, 8409221 - 8409287
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||| |||||||||||| | ||||| | |||||||| ||||| | ||||||||||||||    
8409221 taaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaa 8409287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 510
Target Start/End: Complemental strand, 14975237 - 14975171
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||||||||||||| || | ||||| | |||||||| ||||| | ||||||||||||||    
14975237 taaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaa 14975171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 441 - 510
Target Start/End: Original strand, 12063442 - 12063511
Alignment:
441 tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    ||||||||||||| ||||| |||||||| | ||||||| |||||||||||||  | ||||||| ||||||    
12063442 tgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaaa 12063511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 527 - 606
Target Start/End: Complemental strand, 383837 - 383760
Alignment:
527 gcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||| |||||||||||  | ||||||||||||| | ||||| || ||||||||||||| ||| |||| |||||||||||    
383837 gcgtacaatacaccaaa--ttgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt 383760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 546 - 594
Target Start/End: Original strand, 11395836 - 11395884
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||||||||| || || ||||||||||||||||| ||||    
11395836 tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccacc 11395884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 593
Target Start/End: Complemental strand, 15866194 - 15866052
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||| ||||||| ||||| | || |||| ||| |||| ||||| | |||||  || |||||||||||    || |||||||  ||||||||      
15866194 taaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggt----aaagctgcgt--aatacacc-- 15866103  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    |||||||||||||||||||||||||| || | ||||||| || ||||||||    
15866102 aaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcac 15866052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 533 - 599
Target Start/End: Complemental strand, 16895771 - 16895704
Alignment:
533 aatacaccaaaaatggtgggacccc-ttcccggaccccgcatatgcgggagctttagtgcaccaggtt 599  Q
    ||||||| ||||||||||||||||| |||||||||||  |||||| || || ||||||||||| ||||    
16895771 aatacactaaaaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtt 16895704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 533 - 592
Target Start/End: Original strand, 19340891 - 19340949
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    |||||||||||| || ||||||||||||| |||||| || ||||||| ||||||||||||    
19340891 aatacaccaaaa-tgatgggaccccttcctggacccggcgtatgcggaagctttagtgca 19340949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 588
Target Start/End: Original strand, 24734694 - 24734760
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttag 588  Q
    |||| |||||| |||||| |||||| ||||||||||||||||||| || || ||||| ||||||||||    
24734694 aaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag 24734760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 547 - 606
Target Start/End: Complemental strand, 33922916 - 33922857
Alignment:
547 ggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||| |||||||||||||||| || ||||  |||||||||||||||  |||||||||||    
33922916 ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttt 33922857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 444 - 494
Target Start/End: Complemental strand, 33922985 - 33922935
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacg 494  Q
    ||||||||||||||| ||||||||| | ||| ||| |||||||||||||||    
33922985 taaagttgttgtcatttgactgaaaagtcacaggttcaagtcctagaaacg 33922935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 553 - 602
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
553 accccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    ||||||||| |||||  || |||||||||||||||||||||| |||||||    
30786427 accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc 30786378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 433 - 468
Target Start/End: Complemental strand, 19649336 - 19649300
Alignment:
433 tggcgcaa-tgataaagttgttgtcatgtgactgaaa 468  Q
    |||||||| ||||||||||||||||||||||||||||    
19649336 tggcgcaactgataaagttgttgtcatgtgactgaaa 19649300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 96; Significance: 9e-47; HSPs: 69)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 444 - 611
Target Start/End: Complemental strand, 13730761 - 13730597
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||| ||| ||||||||||    
13730761 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccaa 13730666  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
13730665 taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttttta 13730597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 445 - 606
Target Start/End: Complemental strand, 13628948 - 13628790
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||| ||||||||||    |||||||||| ||||||||||     
13628948 aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggta----aggctgcgtacaatacaccaat 13628853  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
13628852 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 13628790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 46421194 - 46421034
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||| ||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
46421194 taaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 46421099  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttt-agtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || |||||||||||||| |||||||| | |||||||||    
46421098 taatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgcccttt 46421034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 29366879 - 29366720
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||| ||| | ||||||| |||||||| ||||| | ||||||| |||||| |||||||    |||||||||| ||||||||||    
29366879 taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctgcgtacaatacaccaa 29366784  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || |||| ||||||||||||||||  |||||||||||    
29366783 taatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcccttt 29366720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 39203516 - 39203671
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||    ||| |||||| |||||||||||    
39203516 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaa-cagggta----aggttgcgtacaatacaccaaa 39203610  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||  ||||||||||||||||||||||||| |||||||||||    
39203611 --tggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt 39203671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 444 - 605
Target Start/End: Complemental strand, 22123072 - 22122918
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||| |||||||||||||||||||| | | ||||| |||||||| ||||| ||||||||||||||| |||||||    |||||||||| |||||||||||    
22123072 taaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 22122978  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
      ||||||||||||||||||||||| ||||||||| ||||| ||||||||| ||||||||||    
22122977 --tggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt 22122918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 433 - 605
Target Start/End: Original strand, 22609755 - 22609921
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||| | |||||||||||||||||||||| || |  |||||| |||||| | ||||| | |||||||||||||||||||||    ||||||||||     
22609755 tggcgcaacggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggta----aggctgcgtac 22609850  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||  ||||||||||||||||||||||  || ||||||||||||| |||||||| ||||||||||    
22609851 aatacaccaaa--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 40272969 - 40272812
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | || |||| |||||||| |||||   |||||||||||||| |||||||    |||||||||| ||||||||||    
40272969 taaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 40272874  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
40272873 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40272812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 1217090 - 1217245
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||| ||||||| ||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
1217090 taaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 1217184  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||| ||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
1217185 --tggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 1217245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 472 - 606
Target Start/End: Complemental strand, 10795554 - 10795423
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccg 570  Q
    ||||||| |||||||| ||||| | ||||||||||||| ||||||||    |||||||||| ||||||||||||||||||||||||||||| |||||| |    
10795554 cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggta----aggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctg 10795459  T
571 catatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | ||||||||||||| ||||||||||||||||||||    
10795458 cgtatgcgggagcttcagtgcaccaggttgcccttt 10795423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 26869707 - 26869863
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | |||| |||||||||||||||    ||||||||||| ||||||||  |    
26869707 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggt----aaggctgcgtacaatacacc--a 26869800  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||| |||||||  || |||||||||||||| ||||||| |||||||||||    
26869801 aatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcccttt 26869863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 444 - 604
Target Start/End: Complemental strand, 8247846 - 8247688
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    ||| |||||| ||||||||||    
8247846 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa 8247751  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttt-agtgcaccaggttgccct 604  Q
     ||||||||||| ||||||||||||| || |||||||||||||| |||||||  |||||||||    
8247750 taatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct 8247688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 445 - 606
Target Start/End: Complemental strand, 5173876 - 5173719
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    |||||||||||||||||||||||| | ||||||| |||||||| |||||   ||||||||||||||||  |||    ||| ||| |  ||||||||||||    
5173876 aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagta----aggttgcatgcaatacaccaaaa 5173781  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| ||||||||||||||  || |||||||||||||||||||||| |||||||||||    
5173780 atggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt 5173719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 521 - 604
Target Start/End: Complemental strand, 353434 - 353351
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
353434 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 16735441 - 16735597
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| |||| ||||||| |||||||| ||||| | |||||||  |||||||||||    ||||||||||| ||||||||  |    
16735441 taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt----aaggctgcgtacaatacacc--a 16735534  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| | || ||||||| ||||| |||||||  |||||||||||    
16735535 aatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttt 16735597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 444 - 589
Target Start/End: Original strand, 9607203 - 9607345
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||  ||| |||||||| ||||| | |||||| ||||||| |||||||    |||||||||| ||||||||||    
9607203 taaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta----aggctgcgtagaatacaccaa 9607298  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagt 589  Q
     |||| |||||||||||||| ||||||||||||||||||||||||||    
9607299 taatgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 49013558 - 49013473
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||    
49013558 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgcccttt 49013473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 433 - 604
Target Start/End: Original strand, 26573116 - 26573282
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||||||| |||||||||| | ||||||| |||||||| ||||| | ||| |||||||||| |||||||    ||||||||||    
26573116 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggta----aggctgcgta 26573211  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
     ||||||||||   |||||||||||| |||||||||| || |||||| |||||||||||||||||| ||||||    
26573212 caatacaccaat--tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct 26573282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 452 - 606
Target Start/End: Original strand, 516417 - 516569
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaa-tggt 549  Q
    ||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||| | |||| |||||||| |||     
516417 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgcacaataaaccaaaaaatggc 516512  T
550 gggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||| ||||| || |||||||||||||||||||||| |||||||||||    
516513 gggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 516569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 34420801 - 34420643
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||| |||||||||| | ||||||| |||||||| ||||| | |||||||||| ||||||||||    |||||||||||  ||||||| |    
34420801 taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt----aaggctgcgtaccatacacc-a 34420707  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||  || |||| ||||||||||||||||  || ||||||||    
34420706 aaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggctgcccttt 34420643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 480 - 607
Target Start/End: Original strand, 14986993 - 14987117
Alignment:
480 caagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcg 578  Q
    |||||||| ||||| | |||||||||||||| |||||||    |||||||||| |||||||||| ||||||||||||| ||||||||||  |||||||||    
14986993 caagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg 14987088  T
579 ggagctttagtgcaccaggttgccctttg 607  Q
    |||||||||||||||| |||| |||||||    
14987089 ggagctttagtgcaccgggtttccctttg 14987117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 473 - 607
Target Start/End: Original strand, 31592878 - 31593005
Alignment:
473 acgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgca 572  Q
    |||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||  ||||||||| ||||||||||||| |||    
31592878 acgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggactccttcccggaccctgca 31592970  T
573 tatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||||||||| ||||||||| ||||||||||||    
31592971 tatgcgggagctctagtgcaccgggttgccctttg 31593005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 45786299 - 45786214
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| ||  |||| |||||||||||||||| |||||||||||    
45786299 aaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcccttt 45786214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 54484765 - 54484848
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
54484765 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 54484848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 25944469 - 25944627
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||| |||||||||| | || |||| |||||||| ||||| | |||| |||||||||   ||   | ||||||| ||| |||||||||||    
25944469 taaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgg---gcaaggctgagtacaatacaccaaa 25944565  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | ||||||||||||||||| ||||| || |||| ||||||||||| |||||||| ||||||||    
25944566 a-tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgcccttt 25944627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 12914192 - 12914035
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||| ||||||| |||| | |||  || |||||||| ||||| | |||||||||||||| |||||||    |||| ||||| ||||||||||    
12914192 taaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggcggcgtacaatacaccaa 12914097  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||| ||||||||||| ||||| |||||||||||||||| | |||||| |||||||||||    
12914096 a--tggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgcccttt 12914035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 6411978 - 6411834
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||| ||||| | | || |||| |||||| |  |||| | |||||||||||||||||||||    |||||||||| |||||||||||    
6411978 taaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa 6411883  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
      || |||||||||||||| ||||  || ||||||||||||||||||||||    
6411882 --tgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcacc 6411834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 15797294 - 15797377
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||    
15797294 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt 15797377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 455 - 590
Target Start/End: Original strand, 33926094 - 33926224
Alignment:
455 tcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac 554  Q
    |||||||||||||| | || |||| |||||||| ||||  | |||||||||||||||||||||    |||||| ||| ||||||||| || |||||||||    
33926094 tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggta----aggctgtgtacaatacaccataa-tggtgggac 33926188  T
555 cccttcccggaccccgcatatgcgggagctttagtg 590  Q
    ||||||| |||||| ||||||||| |||||||||||    
33926189 cccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 34771447 - 34771364
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| ||||||||||||||| ||||||||| || ||||||||    
34771447 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttt 34771364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 52926367 - 52926219
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | ||||||||||            | ||||||||||| |||||||||||    
52926367 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta------------gtaaggctgcgtacaatacaccaaa 52926280  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||| ||||||||||||| || |||||||||||||||| ||||| |||||||||||    
52926279 --tggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttt 52926219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 444 - 605
Target Start/End: Complemental strand, 7697042 - 7696893
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||| ||| | ||||||| |||||||| ||||| ||||||||||| ||||||||||    ||||||||||| ||||||||  |    
7697042 taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgt-aaaacagggt----aaggctgcgtacaatacacc--a 7696950  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||     ||||||||||||| | ||||||| ||||||| ||||||||| |||| |||||    
7696949 aatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccgggtttccctt 7696893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 521 - 602
Target Start/End: Complemental strand, 54374429 - 54374349
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    ||||||||||| ||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||    
54374429 aaggctgcgtacaatccaccaaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgcc 54374349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 543 - 606
Target Start/End: Complemental strand, 24851364 - 24851301
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||    
24851364 aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttt 24851301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 444 - 535
Target Start/End: Complemental strand, 10870108 - 10870021
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaat 535  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||||||||||    |||||||||||||||    
10870108 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtaaaat 10870021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 53996723 - 53996565
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||| |||||||||| ||||||||| | |||| || |||||| | |||||   |||||||||||||| |||||||    ||||||| || ||||||||||    
53996723 taaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggta----aggctgcttacaatacaccaa 53996628  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    || ||||||||||||||||| ||| | || |||| ||||||||||||||||| || ||||||||    
53996627 aa-tggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttt 53996565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 446 - 586
Target Start/End: Complemental strand, 30928302 - 30928167
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    ||||| ||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| || ||||    ||| || ||||||||||||||      
30928302 aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggta----aggttgtgtaaaatacaccaat- 30928208  T
545 atggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
     ||| ||||||||||||||||||| ||||||| |||||||||    
30928207 -tggcgggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 523 - 606
Target Start/End: Complemental strand, 25517251 - 25517170
Alignment:
523 ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| |||||||  |||||||||||||||||||||||| || || ||||| |||||||||||||||| |||||||||||    
25517251 ggctgcgtacaatacac--aaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcccttt 25517170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 546 - 606
Target Start/End: Original strand, 30452892 - 30452952
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
30452892 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30452952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 455 - 605
Target Start/End: Complemental strand, 45139624 - 45139479
Alignment:
455 tcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaaatggtggga 553  Q
    |||||||||||||| | ||||||| |||||  | |||||   ||||||||||||| ||||||||    ||||||| || |||||||||||||||||||||    
45139624 tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggta----aggctgcatacaatacaccaaaaatggtggga 45139529  T
554 ccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||||| || || || ||||||||| |||| ||||||| || |||||||    
45139528 ccccttcccaga-cctgcgtatgcgggaacttt-gtgcaccgggctgccctt 45139479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 451 - 611
Target Start/End: Original strand, 12525414 - 12525569
Alignment:
451 gttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggt 549  Q
    |||||||| ||||||||| | ||| ||| | |||||| ||||| | |||||||||||||| |||||||    ||||||||  || |||||||||||||||    
12525414 gttgtcatatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta----aggctgcg--aagtacaccaaaaatggt 12525507  T
550 gggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    ||||| ||||||  ||||| |  ||| ||||||||| | ||||||||||||| |||| ||||    
12525508 gggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctcttttttta 12525569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 543 - 592
Target Start/End: Original strand, 35417998 - 35418047
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    |||||||||||||||||||||||||||||| ||||| |||||||||||||    
35417998 aaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgca 35418047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 526 - 594
Target Start/End: Complemental strand, 829521 - 829454
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||| |||||||||||| |||||||||||||||||| |||| || ||||| ||||||||||||||||    
829521 tgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcacc 829454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 551 - 606
Target Start/End: Complemental strand, 10484671 - 10484616
Alignment:
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||| || |||||||||||||||||||||| |||||||||||    
10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10484616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 433 - 542
Target Start/End: Complemental strand, 45620997 - 45620890
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta--aaaacagggtagggaaggctgcgt 530  Q
    |||||||| | |||||||||||||| |||||||||| | ||||||| ||||| || ||||| | ||||||||||  ||||||||||    ||||||||||    
45620997 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggt----aaggctgcgt 45620902  T
531 aaaatacaccaa 542  Q
    | ||||||||||    
45620901 acaatacaccaa 45620890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 433 - 594
Target Start/End: Complemental strand, 45949009 - 45948850
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaa---acgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgc 528  Q
    |||||||| | | |||||||| |||||||||||||   | | ||||||| ||| |||| |||||   ||||||||||||||     ||||| ||||||||    
45949009 tggcgcaacggtgaagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaa----tagggtaaggctgc 45948914  T
529 gtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
     || ||||||||||   ||||||||||||||| ||||||| || ||||||||||||||||||||||    
45948913 atacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcacc 45948850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 497 - 568
Target Start/End: Original strand, 47624095 - 47624160
Alignment:
497 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccc 568  Q
    |||||||||||||||||||||    |||||||||| |||||||||||  |||||||||||||||||||||||    
47624095 ctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccc 47624160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 447 - 602
Target Start/End: Original strand, 7942993 - 7943143
Alignment:
447 agttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaa 545  Q
    ||||||||||||||||||| || | ||||| | |||||||| ||||| |  |||||| |||||| |||||||    || ||||||| |||||| ||||      
7942993 agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggta----agactgcgtacaatacatcaaa-- 7943086  T
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    |||||||| ||||| || ||||  || |||||||||||||||||||||  |||||||    
7943087 tggtgggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc 7943143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 558 - 606
Target Start/End: Original strand, 47624208 - 47624256
Alignment:
558 ttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| || |||||||||||||||||||||| |||||||||||    
47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 47624256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 543 - 606
Target Start/End: Complemental strand, 46170030 - 46169967
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| |||||||||||||||||| ||||||| |||||||| |||||| ||| || ||||||    
46170030 aaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgcatcagattacccttt 46169967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 517
Target Start/End: Original strand, 53062038 - 53062112
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggta 517  Q
    ||||||||||||||||||||||||| | |||| || |||||||| ||||| | ||| ||||| ||||||||||||    
53062038 taaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta 53062112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 444 - 556
Target Start/End: Complemental strand, 4495821 - 4495714
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| ||||||||  |||  | || |||||| |||||||||||    ||||||||||| ||||||||      
4495821 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggt----aaggctgcgtacaatacacc-- 4495728  T
543 aaatggtgggaccc 556  Q
    ||||||||||||||    
4495727 aaatggtgggaccc 4495714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 560 - 612
Target Start/End: Complemental strand, 6242331 - 6242279
Alignment:
560 cccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttat 612  Q
    ||||||||| |||||||| |||||| ||||||||| ||||||||||| |||||    
6242331 cccggaccctgcatatgcaggagctctagtgcaccgggttgccctttttttat 6242279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 542 - 594
Target Start/End: Complemental strand, 44403619 - 44403567
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||||||||||||||||  | ||||| | ||||||||||||||    
44403619 aaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcacc 44403567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 563 - 606
Target Start/End: Complemental strand, 4495719 - 4495676
Alignment:
563 ggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| || |||||||||||||||||||||| |||||||||||    
4495719 ggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 4495676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 24577929 - 24577992
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| || ||||| ||||| |||||| |||||||| ||||||||| | |||||||||    
24577929 aaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttt 24577992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 24578019 - 24578082
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| | ||||| |||||  ||||||||||| || ||||||||| |||||||||||    
24578019 aaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttt 24578082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 26292424 - 26292487
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||| ||||| ||||||||| |||| |||||||||||| || ||||||||| ||||| |||||    
26292424 aaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttgtccttt 26292487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 550 - 605
Target Start/End: Complemental strand, 45288111 - 45288056
Alignment:
550 gggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||| |||||||||||| || |||||  |||||||||||||||||| |||||||    
45288111 gggacctcttcccggaccctgcgtatgcaagagctttagtgcaccaggctgccctt 45288056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 563 - 606
Target Start/End: Complemental strand, 54032614 - 54032571
Alignment:
563 ggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| || |||||||||||||||||||||| |||||||||||    
54032614 ggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 54032571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 592
Target Start/End: Original strand, 40968611 - 40968661
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    ||||||||| ||||||||||  |||||  ||||||||||||||||||||||    
40968611 aaaatggtgagaccccttcctagaccctacatatgcgggagctttagtgca 40968661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 546 - 607
Target Start/End: Complemental strand, 14266431 - 14266371
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    ||||||||||| |||| | |||| || |||||||||||||||||||||  ||||||||||||    
14266431 tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgccctttg 14266371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 561 - 606
Target Start/End: Original strand, 31831298 - 31831343
Alignment:
561 ccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| ||||||||||| ||| ||||||||| |||||||||||    
31831298 ccggaccctgcatatgcgggtgctctagtgcaccgggttgcccttt 31831343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 510
Target Start/End: Original strand, 35417905 - 35417982
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||| | |||||||||| |||||||||||| | | |||| || ||| |||| ||||| | ||||||||||||||    
35417905 tggcgcaacggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaa 35417982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 573 - 606
Target Start/End: Original strand, 40390365 - 40390398
Alignment:
573 tatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||| |||||||||||    
40390365 tatgcgggagctttagtgcaccgggttgcccttt 40390398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 525 - 586
Target Start/End: Original strand, 55401254 - 55401314
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||| |||||||||||| ||||||||||||||| ||||||   | ||||||||||||||    
55401254 ctgcgtataatacaccaaaa-tggtgggaccccttctcggaccttccgtatgcgggagcttt 55401314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 542 - 606
Target Start/End: Complemental strand, 10696277 - 10696213
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||| |||||||||||||||| ||||| || | | ||||||| ||||||||| ||| ||||||||    
10696277 aaaagggtgggaccccttcccagaccctgcgtctacgggagcattagtgcactaggctgcccttt 10696213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 605
Target Start/End: Complemental strand, 31922872 - 31922840
Alignment:
573 tatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||||||||||||||||||||| |||||||    
31922872 tatgcgggagctttagtgcaccaggctgccctt 31922840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 605
Target Start/End: Original strand, 33235655 - 33235687
Alignment:
573 tatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||| |||||||||||||||||||||||||    
33235655 tatgcggaagctttagtgcaccaggttgccctt 33235687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 95; Significance: 4e-46; HSPs: 58)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 41014297 - 41014453
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||||||||||    |||||||||| |||||||||||    
41014297 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa 41014392  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
41014393 --tggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 41014453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 4619263 - 4619104
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||  | |||||||||||||| |||||||    |||||||||| ||||||||||    
4619263 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 4619168  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||    
4619167 taatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt 4619104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 38879559 - 38879718
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| |||||||    |||||||||| ||||||||||    
38879559 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctgcgtacaatacaccaa 38879654  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
38879655 taatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38879718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 43334180 - 43334339
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||| ||||||||||  |||||||    |||||||||| |||||||||    
43334180 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggta----aggctgcgtacaatacacca 43334275  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||||| ||  ||||||||||||||||||||| |||||||||||    
43334276 aaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcccttt 43334339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 453 - 606
Target Start/End: Original strand, 32703411 - 32703557
Alignment:
453 tgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtggg 552  Q
    |||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||  |||||||    
32703411 tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtggg 32703503  T
553 accccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
32703504 accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 32703557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 444 - 592
Target Start/End: Original strand, 27328730 - 27328875
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| |||||||||||||||| |||||||    |||||||||| ||||||||||    
27328730 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 27328825  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
     |||||||||||||||||||| |||| || ||||||||||||||| ||||    
27328826 taatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgca 27328875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 8170139 - 8169984
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||| |||| | ||||||| |||||||| ||||| | || |||||||||| |||||||    |||||||||| |||||||||||    
8170139 taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 8170045  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||| || |||||||| |||||||||||    
8170044 --tggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttt 8169984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 475 - 606
Target Start/End: Complemental strand, 13801895 - 13801767
Alignment:
475 gggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcat 573  Q
    |||| |||||||| ||| | | |||||||||||||| |||||||    |||||||||| |||||||||| ||||||||||||||||||||||||||||||    
13801895 gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcat 13801800  T
574 atgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||| ||||||||||||||| |||||||||||    
13801799 atgcgagagctttagtgcaccgggttgcccttt 13801767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 24448868 - 24449025
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | || |||||||||||     ||||| ||||||||||| ||||||||||    
24448868 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaa----tagggtaaggctgcgtacaatacaccaa 24448963  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || ||||| |||||||||||||||| |||||||||||    
24448964 a--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcccttt 24449025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 35710291 - 35710446
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||| ||||||| | ||||||| |||||||| ||||| | |||||||||||||  ||||||    |||||||||  |||||||||||    
35710291 taaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaat-agggta----aggctgcgttcaatacaccaaa 35710385  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      |||||||||||||||||||| |  ||||||||||||||| ||||||||| |||||||||||    
35710386 --tggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcccttt 35710446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 521 - 605
Target Start/End: Original strand, 20135656 - 20135740
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||    
20135656 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 433 - 593
Target Start/End: Complemental strand, 19143110 - 19142956
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||||| |||| ||||||||| |||||| ||| | ||| ||| |||||||| |||||   ||||||||||||||||||||    |||||||||||     
19143110 tggcgcaatggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggt----aaggctgcgtac 19143015  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    | ||||||  |||||||||||||||||||||||||  || |||||||||| ||||||||||    
19143014 agtacacc--aaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac 19142956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 34154897 - 34154814
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| |||||||||| |||| ||||||||| |||||||||||    
34154897 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt 34154814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 535 - 607
Target Start/End: Original strand, 25622524 - 25622596
Alignment:
535 tacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||| | ||||||||||    
25622524 tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttg 25622596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 16957386 - 16957449
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
16957386 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 16957449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 433 - 594
Target Start/End: Original strand, 43574564 - 43574729
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacac---------gggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaa 522  Q
    ||||||||||||||||||||||||| |||||||||| | |||         | || |||||||| |||||  ||||||||||| |||||||||||    |    
43574564 tggcgcaatgataaagttgttgtcacgtgactgaaaggtcacttcggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggta----a 43574659  T
523 ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||| |||| ||||||  ||||||||||||||||||||||| || |||||||||||||||| |||||    
43574660 ggctgcgtacaatataccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagagcacc 43574729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 481 - 603
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
481 aagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcggg 580  Q
    ||||||| ||||| | ||||||||||||| |||||||    |||||||||| ||||||||||   ||||||||||||||||||||||| ||||||| |||    
7368413 aagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtggg 7368505  T
581 agctttagtgcaccaggttgccc 603  Q
    |||| ||||||||| ||||||||    
7368506 agctctagtgcaccgggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 28516591 - 28516433
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||| ||| |||||| | ||||||| |||||| | |||||   |||||||||||||| |||| |||||    ||||||| |||||| |||    
28516591 taaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctaggg----ctgcgtacaatacatcaa 28516496  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    || ||||||||||| ||||| ||||| ||  |||| |||||||||||| |||||||||||||||    
28516495 aa-tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgcccttt 28516433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 497 - 606
Target Start/End: Complemental strand, 7097863 - 7097760
Alignment:
497 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccag 596  Q
    |||||||||||||||||||||    ||| |||||| |||||||||||  ||||| |||||||||||| |||| || |||||||||||||||||||||||     
7097863 ctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaa--tggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcaccat 7097770  T
597 gttgcccttt 606  Q
    | ||||||||    
7097769 gctgcccttt 7097760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 533 - 605
Target Start/End: Complemental strand, 12006401 - 12006329
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||||  |||||||||    
12006401 aatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt 12006329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 1565409 - 1565566
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | | ||||| |||||||| |||||   |||||| ||||||| |   ||   ||||||||||| ||| |||||||    
1565409 taaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaaca-tatt-aaggctgcgtacaatgcaccaaa 1565506  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||| ||||||||||||||||||| ||||||| |||||| |||||||||| |||||||||||    
1565507 --tggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcccttt 1565566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 547 - 606
Target Start/End: Complemental strand, 16028683 - 16028624
Alignment:
547 ggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
16028683 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 16028624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 441 - 594
Target Start/End: Complemental strand, 22861826 - 22861681
Alignment:
441 tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacc 540  Q
    |||||||||||||||||||||||||||| | ||||| | |||||||||||| | |||||||||||||||       | | ||| ||||  | |||||| |    
22861826 tgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaa------caagtaagactgctcacaatacatc 22861733  T
541 aaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
      |||||||||||||||||| || |||| ||||||||||||||| |||||||||    
22861732 --aaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcacc 22861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 22187263 - 22187422
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||| ||||||||| | ||| |||  ||||||| ||||| | |||||||||||||| || | ||    || ||||||| ||||||||||    
22187263 taaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgata----agactgcgtacaatacaccaa 22187358  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||   || |||||||||||  ||||  ||||||| |||||||||||||| |||||||||||||    
22187359 aaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttt 22187422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 209084 - 208939
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||| ||| | |||  || |||||||| | |||   |||||||||||||||||||||    ||||||| |  |||||||||||    
209084 taaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggta----aggctgcattcaatacaccaaa 208989  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    | |||||||||||||||| |||||| |  |||||  |||||||||||||||    
208988 a-tggtgggaccccttcctggaccctgggtatgcaagagctttagtgcacc 208939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 433 - 594
Target Start/End: Original strand, 39301090 - 39301246
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgta 531  Q
    |||||||| | ||||||||||||||||| ||||||| | ||||||| |||||| | | |||   |||||||||| ||||||||||    |||| ||||||    
39301090 tggcgcaacggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggt----aaggatgcgta 39301185  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
     ||| ||||||||| ||||||||||||||||||||||  | |||| ||||| |||||||||||    
39301186 taatgcaccaaaaa-ggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcacc 39301246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 444 - 583
Target Start/End: Original strand, 2838756 - 2838890
Alignment:
444 taaagttgttgtcatgtgactg-aaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| ||| | |||| |  ||||||  |||||| |  ||||||||||||||||||||    |||||||||| ||||||||||    
2838756 taaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaacagggta----aggctgcgtacaatacaccaa 2838851  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagc 583  Q
    |  |||||||| |||||| ||||||| || |||||||||||    
2838852 a--tggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 606
Target Start/End: Complemental strand, 30877623 - 30877564
Alignment:
547 ggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||    
30877623 ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt 30877564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 16880730 - 16880647
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||| |||| |||||||||||  || |||||||||||||||||||||| |||| ||||||    
16880730 aaggctgcgtacaatacaccaaa--tggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttcccttt 16880647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 509
Target Start/End: Complemental strand, 37024711 - 37024646
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa 509  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||    
37024711 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa 37024646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 526 - 606
Target Start/End: Complemental strand, 12575739 - 12575660
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| |||||||||||| |||||||||||||||| |||||| || ||||| |||||||| ||||||| || ||||||||    
12575739 tgcgtacaatacaccaaaa-tggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcccttt 12575660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 444 - 586
Target Start/End: Original strand, 22600432 - 22600569
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||| ||||||||||| || |  |||||| |||||||| |||||  | | |||||||||| ||||||||    |||||| ||| ||||||||||    
22600432 taaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggta----aggctgtgtacaatacaccaa 22600527  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    |  |||||||| ||||||||||| || || ||||||||||||||    
22600528 a--tggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 533 - 587
Target Start/End: Complemental strand, 10306546 - 10306493
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttta 587  Q
    |||||||||||| ||||||||||||||||||||||| || |||||||||||||||    
10306546 aatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagcttta 10306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 542 - 595
Target Start/End: Complemental strand, 4654479 - 4654426
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacca 595  Q
    |||||||||||| |||||| || |||| ||||||||||||||||||||||||||    
4654479 aaaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacca 4654426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 11657783 - 11657699
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| || |||||||||||| |||||||||||||||||| |||| ||| | |||||| ||||||| |||| || ||||||||    
11657783 aaggctgcatacaatacaccaaaa-tggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttt 11657699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 594
Target Start/End: Complemental strand, 12477204 - 12477132
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||||||| ||||||||||||||||||||  | || |||||  |||||||||||||||    
12477204 aaggctgcgtacaatacaccaaaa-tggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 542 - 603
Target Start/End: Complemental strand, 21784396 - 21784335
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    |||||||||||||||||| |||||||| || |||||||||| |||||||||||  |||||||    
21784396 aaaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc 21784335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 433 - 510
Target Start/End: Original strand, 23974747 - 23974824
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||| | |||||||||||||||||||||| || | ||||||| |||||||| |||||   ||||||||||||||    
23974747 tggcgcaacggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaa 23974824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 29334447 - 29334531
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| ||||||||| || ||||||||||| ||||||||||| || |||| |||| ||||| |||||| || ||||||||    
29334447 aaggctgcgtacaatacaccagaa-tggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgcccttt 29334531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 550 - 606
Target Start/End: Complemental strand, 10943900 - 10943845
Alignment:
550 gggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||| ||| ||||||||||||||||||||| || ||||||||    
10943900 gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttt 10943845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 546 - 602
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    ||||||||||||||||| |||||  | |||||||||||||||||||||| |||||||    
39801591 tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc 39801647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 562 - 605
Target Start/End: Original strand, 19438757 - 19438800
Alignment:
562 cggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||    
19438757 cggaccctgcatatgcgggagctctagtgcaccaggttgccctt 19438800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 555 - 606
Target Start/End: Original strand, 32354211 - 32354262
Alignment:
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||| |  |||||||||||||||||||||| |||||||||||    
32354211 cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 32354262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 544 - 594
Target Start/End: Original strand, 29297864 - 29297914
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||| |||||||||||||||||| || |||| |||||||||||||    
29297864 aatggtgggatcccttcccggaccccgcaaatacgggtgctttagtgcacc 29297914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 526 - 606
Target Start/End: Original strand, 1405244 - 1405322
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| |||||||||||  ||||||||||| |||| | |||| ||||||||||||||| |||| |||| | |||||||||    
1405244 tgcgtacaatacaccaaa--tggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgcccttt 1405322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 546 - 606
Target Start/End: Original strand, 3771414 - 3771474
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||| | |  |||| ||||||||||||||||| || ||||||||    
3771414 tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgcccttt 3771474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 451 - 558
Target Start/End: Complemental strand, 22908014 - 22907913
Alignment:
451 gttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtg 550  Q
    ||||| |||||||||||| | || |||| ||||||| |||||| | ||||||||||||||||| ||    |||| ||| || ||||||||  ||||||||    
22908014 gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagt----aaggttgcatacaatacacc--aaatggtg 22907921  T
551 ggacccct 558  Q
    ||||||||    
22907920 ggacccct 22907913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 521 - 608
Target Start/End: Complemental strand, 42924917 - 42924828
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccgg--accccgcatatgcgggagctttagtgcaccaggttgccctttgt 608  Q
    |||| |||||| ||||||||||||||| ||| | |||||||| |  |||| || ||||||| |||||||||||||| | ||| |||||||    
42924917 aaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcaccggattgtcctttgt 42924828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 584
Target Start/End: Complemental strand, 21542530 - 21542489
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagct 584  Q
    |||||||||||||||||||||||| | || ||||||||||||    
21542530 aaatggtgggaccccttcccggactctgcgtatgcgggagct 21542489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 468
Target Start/End: Complemental strand, 28208269 - 28208240
Alignment:
439 aatgataaagttgttgtcatgtgactgaaa 468  Q
    ||||||||||||||||||||||||||||||    
28208269 aatgataaagttgttgtcatgtgactgaaa 28208240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 546 - 606
Target Start/End: Complemental strand, 5873382 - 5873322
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| ||| ||||||| | || |||||||||||||||||||| | || ||||||||    
5873382 tggtgggactcctccccggacactgcgtatgcgggagctttagtgcatcgggatgcccttt 5873322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 433 - 493
Target Start/End: Complemental strand, 10634314 - 10634254
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaac 493  Q
    |||||||| | | |||||||||||| |||||||||| | || |||| ||||||||||||||    
10634314 tggcgcaacggtgaagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaac 10634254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 436 - 468
Target Start/End: Complemental strand, 12622224 - 12622192
Alignment:
436 cgcaatgataaagttgttgtcatgtgactgaaa 468  Q
    |||||||||||||||||||||| ||||||||||    
12622224 cgcaatgataaagttgttgtcacgtgactgaaa 12622192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 542 - 606
Target Start/End: Original strand, 19093884 - 19093948
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||  ||||||| ||||||||| || ||||  |||||||||||||||| || ||||||||    
19093884 aaaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttt 19093948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 605
Target Start/End: Complemental strand, 29184094 - 29184062
Alignment:
573 tatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||||||||||||| ||||||||||    
29184094 tatgcgggagctttagtgcaccgggttgccctt 29184062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 446 - 510
Target Start/End: Complemental strand, 34074717 - 34074653
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    ||||||||||||  ||||||||| | |||  || |||||||||||||| | ||||||||||||||    
34074717 aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaa 34074653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 533 - 593
Target Start/End: Complemental strand, 39079823 - 39079764
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    |||||||||||| ||||||||||||||||||||||  |  ||| |||||| ||||||||||    
39079823 aatacaccaaaa-tggtgggaccccttcccggaccatgtgtatacgggagttttagtgcac 39079764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 433 - 485
Target Start/End: Complemental strand, 39079934 - 39079882
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtc 485  Q
    |||||||| | |||||||||||||||||||| |||| | ||||||| ||||||    
39079934 tggcgcaacggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagtc 39079882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 91; Significance: 9e-44; HSPs: 81)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 16408760 - 16408601
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    || ||||||| ||||||||||    
16408760 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa 16408665  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16408664 taatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 16408601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 5648237 - 5648393
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | ||||||||||||||||||||    ||||||||||| ||||||||  |    
5648237 taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a 5648330  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || ||||||||||||| |||||||  |||||||||||    
5648331 aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttt 5648393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 30639358 - 30639514
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||| ||||||||||| | ||| ||| |||||||| ||||| | |||||||||||||||||||||    |||||||||| |||||||||||    
30639358 taaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa 30639453  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||| ||||||||||||||||| ||||||||||||||||||||||||  |||||||||||    
30639454 --tggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcccttt 30639514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 444 - 605
Target Start/End: Complemental strand, 6430782 - 6430627
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||| | ||||| | ||||||||||||||||||||    ||||||||||| ||||||||  |    
6430782 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a 6430689  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||| |||||||||||| || |||||||||||||||| ||||| ||||||||||    
6430688 aatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 6430627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 607
Target Start/End: Original strand, 20224962 - 20225118
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | || |||| |||||||| |||||   ||||||||||||| |||||||    |||||||||| |||||||||||    
20224962 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 20225056  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||    
20225057 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttg 20225118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 603
Target Start/End: Original strand, 21646942 - 21647098
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||| ||| |||||||| ||||| | ||||||||||||||     ||||| ||||||||||| |||| |||||    
21646942 taaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaa----tagggtaaggctgcgtacaatataccaa 21647037  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
21647038 taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 16911540 - 16911699
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||| ||| | ||||||| |||||||||||||| | |||||||||| ||| |||||||    |||||||||| ||||||||||    
16911540 taaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggta----aggctgcgtacaatacaccaa 16911635  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || || ||||||||||||||  ||| |||||||||||    
16911636 taatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgcccttt 16911699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 44363289 - 44363130
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | |||| || ||||||||  |||| | ||| |||||||||| ||||||||||    ||||||| ||  ||||||    
44363289 taaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtaggg----ctgcgtacaacgcaccaa 44363194  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
44363193 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 44363130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 48598980 - 48598825
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
48598980 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 48598886  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||  |||||||| |||||| ||||||||| |||||||||||    
48598885 --tggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttt 48598825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 433 - 606
Target Start/End: Original strand, 54175031 - 54175200
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaa-cggtctcttgtgtaaaaacagggtagggaaggctgcgta 531  Q
    |||||||| ||||| ||||||||||||||||||||| | ||||| | |||||||| |||| | | |||||||||||||||||||||    ||||||||||    
54175031 tggcgcaacgataa-gttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggta----aggctgcgta 54175125  T
532 aaatacaccaaaaatggtgggaccccttccc-ggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||| || ||||||||    
54175126 caatacaccaaaa-tggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttt 54175200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 23501771 - 23501924
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| ||||||      || | |||||||||||||| |||||||    ||| |||||| ||||||||||    
23501771 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa 23501860  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||    
23501861 taatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 23501924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 11054303 - 11054148
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| ||||||||  |||| ||||||||||||||| |||||||    || ||||||| |||||||||||    
11054303 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaa-cagggta----agactgcgtacaatacaccaaa 11054209  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||| || |||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
11054208 --tggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 11054148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 47528685 - 47528530
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
47528685 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 47528591  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| | ||||| ||||||| ||||||||| |||||||||||    
47528590 --tggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgcccttt 47528530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 20225126 - 20225211
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
20225126 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 20225211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 611
Target Start/End: Complemental strand, 30352748 - 30352575
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa------cagggtagggaaggctgcgtaaaatac 537  Q
    |||||||||||||| ||||| |||| | |||||||   |||||| ||||| | ||||||||||||||      ||||||| | || |||||||| |||||    
30352748 taaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaagtaaagctgcgtacaatac 30352649  T
538 accaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    ||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  |||||||||| ||||    
30352648 accaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttttttta 30352575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 444 - 605
Target Start/End: Original strand, 40915807 - 40915962
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||  || | ||||||| |||||||| ||||| | |||||||||||||||| ||||    |||||||||| |||||||||||    
40915807 taaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggta----aggctgcgtacaatacaccaaa 40915902  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
      |||||||| |||||||||||||| || ||||||||||||| |||||||| | ||||||||    
40915903 --tggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt 40915962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 444 - 594
Target Start/End: Original strand, 54730227 - 54730375
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||  ||| | ||||||| |||||||||||||| | |||||||||||||| |   ||||  ||||||||||| ||||||||||    
54730227 taaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaa---taggataaggctgcgtataatacaccaa 54730323  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
     |||| ||| |||||||||||||||| || ||||||||||||||||||||||    
54730324 taatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc 54730375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 458 - 604
Target Start/End: Complemental strand, 29208039 - 29207900
Alignment:
458 tgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccc 557  Q
    ||||||||||| | ||||||| |||||||| ||||  | ||||||||||||| |||||||    |||||||||| |||||||||||  ||||||||||||    
29208039 tgtgactgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggacccc 29207947  T
558 ttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    ||||||||||| ||||||||||||||| ||||||||| |||||||||    
29207946 ttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 5306820 - 5306660
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||| |||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||    |||| |||||| ||||||||  |    
5306820 taaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggt----aaggttgcgtacaatacacc--a 5306727  T
544 aatggtgggaccccttcccggaccccgcatatg----cgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || ||||    ||||||||||| |||||| |||||||||||    
5306726 aatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgcccttt 5306660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 13256554 - 13256399
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||  ||| |||||||| ||    | |||||||||||||| |||||||    |||||||||| ||||||||||    
13256554 taaagttgttgtcatgtgactggaaggtcataggttcaagtcctgga----gcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 13256463  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||| |||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||    
13256462 taatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcccttt 13256399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 483 - 611
Target Start/End: Complemental strand, 20639777 - 20639653
Alignment:
483 gtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcggga 581  Q
    ||||| ||||| | |||||||||||||| |||||||    |||||||||| |||||||||||| ||||||||||||||||||||||| || |||||||||    
20639777 gtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcggga 20639683  T
582 gctttagtgcaccaggttgccctttgttta 611  Q
    ||||||||||||| ||||||||||| ||||    
20639682 gctttagtgcaccgggttgcccttttttta 20639653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 443 - 606
Target Start/End: Complemental strand, 9832469 - 9832313
Alignment:
443 ataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||| ||||||| || ||||||||| | ||||||| ||||||||  |||| | ||||||||||||| |||||||    |||||||||| ||||||||||    
9832469 ataaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaa 9832375  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| |||||||| ||| || ||||||||| |||||||||||    
9832374 a--tggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttt 9832313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 446 - 603
Target Start/End: Complemental strand, 17043549 - 17043398
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    |||||||||||| |||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||||    |||||||||| |||||||||||     
17043549 aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggta----aggctgcgtacaatacaccaaa- 17043455  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
     ||||||||||||||||| ||||| |||||||| ||||||||| ||||||||| |||||    
17043454 -tggtgggaccccttcccagaccctgcatatgctggagcttta-tgcaccaggctgccc 17043398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 444 - 607
Target Start/End: Original strand, 20405071 - 20405225
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    |||||||||||||||||||||| || | ||||||       ||||||||| | ||||||||||||||  |||||||    ||  |||||| ||||||| |    
20405071 taaagttgttgtcatgtgactggaaggtcacggg-------cctagaaacagcctcttgtgtaaaaaaacagggta----agattgcgtacaatacacta 20405159  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||    
20405160 ataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgccctttg 20405225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 533 - 613
Target Start/End: Complemental strand, 33836560 - 33836480
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttatt 613  Q
    |||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||| | ||||||||||| ||||||    
33836560 aatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttttatt 33836480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 472 - 606
Target Start/End: Original strand, 47443963 - 47444092
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccg 570  Q
    ||||||| |||||||| ||||| | |||||| ||||||| |||||||    |||||||||| |||||||||||  ||||||||||||||||||||||| |    
47443963 cacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctg 47444056  T
571 catatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| ||||||| |||||||  |||||||||||    
47444057 catatgcaggagcttcagtgcactgggttgcccttt 47444092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 25629101 - 25629184
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| ||| |||||||||||  |||||||||||||||||||||||  |||||||||||||||||||||||| |||||||||||    
25629101 aaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcccttt 25629184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 20908720 - 20908636
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||| |||||||||||||||||| |||| || ||||||||||||||||||||| ||| ||||||||    
20908720 aaggctgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttt 20908636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 452 - 606
Target Start/End: Original strand, 25463108 - 25463256
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgg 551  Q
    ||||||||||||||||| | ||||||| |||||||| |||||   ||||||||||||||   || |   |||| |||||| || ||||||||  ||||||    
25463108 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactggga---aaggttgcgtacaacacaccaaa--tggtgg 25463202  T
552 gaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||| | ||||||    
25463203 gaccccttcccggaccctgcatatgcgggagcttt-gtgcaccaggctacccttt 25463256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 30690340 - 30690176
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaac---agggtaggg-aaggctgcgtaaaatacac 539  Q
    |||||| ||||||| |||||||||| | ||||||| |||||||| ||||  | ||||||||||||||    |    |||| |||||||| || |||||||    
30690340 taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac 30690241  T
540 caaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||   ||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||    
30690240 caat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt 30690176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 545 - 606
Target Start/End: Original strand, 32484307 - 32484368
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||    
32484307 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 32484368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 543 - 612
Target Start/End: Original strand, 38786681 - 38786750
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttat 612  Q
    |||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |||||    
38786681 aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttttat 38786750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 447 - 611
Target Start/End: Complemental strand, 39077948 - 39077791
Alignment:
447 agttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaat 546  Q
    |||||||||||||||| ||||| | ||||||| |||||||| ||||| | ||||||||| ||||||||||    |||| |||||| |||| |||  ||||    
39077948 agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggt----aaggttgcgtacaatatacc--aaat 39077856  T
547 ggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||| |||  ||| |||||||| ||||||||||||||| ||||||||| ||||||| ||| ||||    
39077855 ggtgagacatctttccggaccctgcatatgcgggagctctagtgcaccgggttgcctttttttta 39077791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 484 - 610
Target Start/End: Complemental strand, 7909397 - 7909276
Alignment:
484 tcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgc-gggag 582  Q
    |||| ||||| |||||||||||||||||||||||    ||| |||||| |||||||||||  |||||||||||||||||| |||| || ||||| |||||    
7909397 tcctggaaacagtctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcggggag 7909304  T
583 ctttagtgcaccaggttgccctttgttt 610  Q
    |||||||||| | |||||||||| ||||    
7909303 ctttagtgcatcgggttgcccttagttt 7909276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 35567148 - 35567305
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||| ||||||| | || |||| |||||| | ||||| | | |||||||||||| |||||||    |||||| ||| || |||||||    
35567148 taaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggta----aggctgtgtacaacacaccaa 35567243  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||||||||||||||| |||| || | |||||||||||||||||||| || ||||||||    
35567244 a--tggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgcccttt 35567305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 433 - 603
Target Start/End: Original strand, 25343154 - 25343321
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgta 531  Q
    |||||||||| |||||||||||||| |||||||| | | ||| ||| ||||| || ||||  ||||||||||| |||||||||||    |||||||||||    
25343154 tggcgcaatggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggt----aaggctgcgta 25343249  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
     ||||||||||||| ||| |||||||||||  || || || |||| | ||||||||| ||||| || |||||    
25343250 caatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggctgccc 25343321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 440 - 606
Target Start/End: Complemental strand, 32478946 - 32478792
Alignment:
440 atgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacac 539  Q
    |||||||||||||||||||||||| || | | ||| ||| |||||||| |||||   |||| ||||||||||||||||    ||||||     |||||||    
32478946 atgataaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggta----aggctg-----aatacac 32478856  T
540 caaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||  ||||||||||||||||||||||| || |||||||||||||| ||||||| ||| |||||||    
32478855 caaa--tggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggcccttt 32478792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 544 - 606
Target Start/End: Complemental strand, 38755970 - 38755908
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38755908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 445 - 588
Target Start/End: Complemental strand, 49938746 - 49938611
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    ||||||||||||| |||||||||| | ||| ||| |||||||| ||||| | ||||||||||||||| ||||| |       | ||| |||||||| |||    
49938746 aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag-------gtgtacaatacacc-aaa 49938655  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttag 588  Q
    ||||||||||||||||||  |||| |||||||||||||||||||    
49938654 atggtgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 433 - 568
Target Start/End: Complemental strand, 47441698 - 47441568
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||||||| |||||||||| | ||| ||| ||||||| |||||| ||||||| |||||||| ||||||    ||||||| |||    
47441698 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggt----aaggctgtgta 47441603  T
532 aaatacaccaaaaatggtgggaccccttcccggaccc 568  Q
     ||||||||  ||||||| ||||||||||||||||||    
47441602 caatacacc--aaatggttggaccccttcccggaccc 47441568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 521 - 605
Target Start/End: Complemental strand, 8473705 - 8473621
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttccc-ggacccc-gcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||| || |||||||||||  ||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||    
8473705 aaggctgcatacaatacaccaaa--tggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt 8473621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 11394924 - 11394987
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||| |||||||| || |||||||||||||||||||||| |||||||||||    
11394924 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11394987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 11404651 - 11404714
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||| |||||||| || |||||||||||||||||||||| |||||||||||    
11404651 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11404714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 14983906 - 14983969
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||| || |||||||||||||||||| |||| ||||||||||    
14983906 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 14983969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 436 - 594
Target Start/End: Original strand, 19027818 - 19027971
Alignment:
436 cgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaa 534  Q
    ||||||| || ||||||||||| |||||||||| | ||||||| |||||||| |||||    |||||||| |||||||||||    ||||||||||| ||    
19027818 cgcaatggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggt----aaggctgcgtacaa 19027913  T
535 tacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||  || |||||||||||||| || ||| | || |||| |||||||||||||||||    
19027914 tacacc--aattggtgggacccctttccagactctgcgtatgtgggagctttagtgcacc 19027971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 545 - 606
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| ||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
40553998 atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40553937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 523 - 606
Target Start/End: Complemental strand, 36816466 - 36816384
Alignment:
523 ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| ||||||||||||| |||||||| |||||| |||||| |  |||||||||||||||||| ||| |||||||||||    
36816466 ggctgcgtacaatacaccaaaaa-ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttt 36816384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 495 - 606
Target Start/End: Complemental strand, 48327871 - 48327763
Alignment:
495 gtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    |||||||||||||||| |||||||    || |||| || |||||||||| |||||||||||| ||||||| ||||| ||||||||| || ||||||||||    
48327871 gtctcttgtgtaaaaaacagggta----agactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcac 48327776  T
594 caggttgcccttt 606  Q
    | |||| ||||||    
48327775 cgggttacccttt 48327763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 555 - 606
Target Start/End: Original strand, 56322984 - 56323035
Alignment:
555 cccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||| ||||||||||||||||||||||| |||||||||||    
56322984 cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttt 56323035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 544 - 606
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || |||||  ||||||||||||||| |||||||||||    
25388249 aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt 25388311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 538 - 592
Target Start/End: Complemental strand, 47482918 - 47482864
Alignment:
538 accaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||| |||||    
47482918 accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca 47482864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 521 - 594
Target Start/End: Complemental strand, 51865121 - 51865050
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||||||  ||||||| ||||||||||||||| || ||||||||||||||| ||||||    
51865121 aaggctgcgtacaatacaccaaa--tggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc 51865050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 546 - 606
Target Start/End: Original strand, 19027986 - 19028046
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| |||||||||||||| | |||||||||||||||||||||| || ||||||||    
19027986 tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttt 19028046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 444 - 588
Target Start/End: Complemental strand, 39029218 - 39029078
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||| ||||||| ||| | ||  ||| |||| | | ||||| | |||||||||||||| |||||||    |||||| ||| ||||||| ||    
39029218 taaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggta----aggctgtgtacaatacacgaa 39029123  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttag 588  Q
    || |||||||||| ||| |||||||| |||||||||||||||||||    
39029122 aa-tggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 433 - 517
Target Start/End: Complemental strand, 42164316 - 42164232
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||| | |||| |||||||||||||||||||| | ||||||| |||||| | |||||   |||||||||||||||||||||    
42164316 tggcgcaacggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggta 42164232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 433 - 590
Target Start/End: Complemental strand, 30581635 - 30581481
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgt 530  Q
    |||||||| | ||||||||||||||  | ||| ||| | || |||| |||||| | |||||   ||||||||||||||  |||||||    ||| || ||    
30581635 tggcgcaacgctaaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggta----agggtgtgt 30581540  T
531 aaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 590  Q
    | |||||||||||| ||||||||||||||||||||||| |||||||  ||||||||||||    
30581539 acaatacaccaaaa-tggtgggaccccttcccggaccctgcatatgtaggagctttagtg 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 444 - 510
Target Start/End: Original strand, 14590815 - 14590881
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    ||||||||||||||||||||||||| | ||||| | |||||||||||||| | ||||||| ||||||    
14590815 taaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaa 14590881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 556 - 606
Target Start/End: Original strand, 35532077 - 35532127
Alignment:
556 ccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||| || |||||||||||||||||||||| |||||||||||    
35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 35532127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 444 - 517
Target Start/End: Complemental strand, 17315455 - 17315382
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    ||||||||||||||||||||||||| | ||||||| ||| |||| |||||   |||||||||||||||| ||||    
17315455 taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggta 17315382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 444 - 592
Target Start/End: Original strand, 37494829 - 37494972
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||| |||| |||||||| | ||| ||| |||||||| |||||   |||||||||||||| |||||||    ||| ||| || |||| |||||    
37494829 taaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggttgcatacaatataccaa 37494924  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    |  |||||||||||||| | |||||| || ||||| ||||||||||||||    
37494925 a--tggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 545 - 606
Target Start/End: Original strand, 44718641 - 44718702
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||| ||||| || ||||||||||||||||  |||| |||||||||||    
44718641 atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt 44718702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 585
Target Start/End: Original strand, 49796849 - 49796911
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctt 585  Q
    ||||||||||| |||||||||||  |||||||||||||||||| |||| || |||||||||||||    
49796849 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 525 - 593
Target Start/End: Original strand, 21489143 - 21489210
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    ||||||| ||| |||||||| |||||||||||||||||| |||| || |||||||||||||| ||||||    
21489143 ctgcgtacaatgcaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcac 21489210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 449 - 593
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
449 ttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatgg 548  Q
    ||||||||| |||||||||| | ||||||| |||||||| |||||   |||||||||||||  |||||    |||||| |||| ||||||||  |||| |    
41018945 ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggt----aaggctacgtacaatacacc--aaatag 41018852  T
549 tgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    |||||||||||||| ||||  || ||||  || ||||||||||||    
41018851 tgggaccccttcccagaccttgcgtatggaggggctttagtgcac 41018807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 444 - 607
Target Start/End: Complemental strand, 55766623 - 55766465
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacggg-tccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||| | || | |||||| | |||||  | ||||| || ||||||||  ||||||||||    |||||||||| |||||||  |    
55766623 taaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaacagggta----aggctgcgtacaatacactga 55766528  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |  |||||| ||||| |||||||||  || |||||| ||||||||||||||| || |||||||||    
55766527 a--tggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccctttg 55766465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 444 - 607
Target Start/End: Complemental strand, 55830878 - 55830720
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgg-gtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||  | || | ||||| || |||||  | ||||| |||||||||||  ||||||||||    | |||||||| |||||||  |    
55830878 taaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaacagggta----atgctgcgtacaatacactga 55830783  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |  |||||| ||||| |||||||||  || |||||| |||||||||||||||||| |||||||||    
55830782 a--tggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccctttg 55830720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 444 - 594
Target Start/End: Complemental strand, 487292 - 487138
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||| | |||||   |||||||||| ||||||    ||| || |||||||| ||||||| ||    
487292 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaaca----aggtaaagctgcgtacaatacactaa 487197  T
543 aa-------atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||       |||| ||||||||||||||||  | ||  |||||||||||||||||||||    
487196 aatggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttagtgcacc 487138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 543 - 594
Target Start/End: Original strand, 28494223 - 28494274
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||||||||||| || || ||||||||||||||| |||||||||    
28494223 aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcacc 28494274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 544 - 611
Target Start/End: Complemental strand, 50555718 - 50555651
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||||| |||||||||||||||| || ||||| |||| ||||||||||| || |||||||| ||||    
50555718 aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttttta 50555651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 433 - 603
Target Start/End: Original strand, 54966988 - 54967151
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta 531  Q
    |||||||| | ||||||||||||||||||||||||| | |||  || ||||| || ||||    |||||||||||||| |||||||    ||| ||| ||    
54966988 tggcgcaacggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggta----aggttgc-ta 54967082  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
     |||| ||||||  |||||||||||||||||| ||||  |||||||||||||||| ||||||| || |||||    
54967083 caatataccaaa--tggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc 54967151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 594
Target Start/End: Complemental strand, 9987917 - 9987846
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||| || |||||||||||  ||||||||||||||||  ||||  |||||||||||||||||| ||||||    
9987917 aaggctgcatacaatacaccaaa--tggtgggaccccttccttgaccttgcatatgcgggagctttaatgcacc 9987846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 10277840 - 10277757
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  |||||  |||||||||| ||||| ||||||||||||| | ||||| ||| | |||||||||    
10277840 aaggctgcgtacaatacaccaaa--tggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgcccttt 10277757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 524 - 590
Target Start/End: Original strand, 16494272 - 16494338
Alignment:
524 gctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 590  Q
    ||||| || |||||||||||||||||||||||| ||||| ||||| |  ||||||| ||||||||||    
16494272 gctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtg 16494338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 510
Target Start/End: Complemental strand, 23580365 - 23580299
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||||| |||||||||| | ||||||| ||||| |||||||  | ||||||||||||||    
23580365 taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaa 23580299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 525 - 608
Target Start/End: Original strand, 2813181 - 2813265
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt-agtgcaccaggttgccctttgt 608  Q
    ||||||| |||||| ||| ||||||||||||| |||||| ||   || |||||||||||||| |||||||| | |||||||||||    
2813181 ctgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccctttgt 2813265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 449 - 583
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
449 ttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaatacaccaaaaatg 547  Q
    |||||||||||||||||||| | ||||||| |||| ||| ||||| | ||| ||||| ||||| |||||    |||| || ||  ||||||||  |||||    
7385628 ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggt----aaggttgtgtgcaatacacc--aaatg 7385535  T
548 gtgggaccccttcccggaccccgcatatgcgggagc 583  Q
    ||||||||| ||||||||||| |  |||||||||||    
7385534 gtgggaccctttcccggaccctgtgtatgcgggagc 7385499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 544 - 606
Target Start/End: Original strand, 8820581 - 8820643
Alignment:
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||| ||||| || |||||| ||| ||||||||| ||| ||| |||||    
8820581 aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgcatcagattgtccttt 8820643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 451 - 517
Target Start/End: Complemental strand, 32629418 - 32629352
Alignment:
451 gttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    |||||||||||||||||| | ||||||| ||| |||| ||||| | |||||||  ||||||||||||    
32629418 gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggta 32629352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 510
Target Start/End: Complemental strand, 54640507 - 54640430
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||| | |||| ||||||||| ||| |||||| | ||||||| |||||| | ||||| | ||||||||||||||    
54640507 tggcgcaacggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaa 54640430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 557 - 597
Target Start/End: Complemental strand, 37038172 - 37038132
Alignment:
557 cttcccggaccccgcatatgcgggagctttagtgcaccagg 597  Q
    ||||||| |||| || |||||||||||||||||||||||||    
37038172 cttcccgtaccctgcgtatgcgggagctttagtgcaccagg 37038132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 433 - 493
Target Start/End: Complemental strand, 50856404 - 50856344
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaac 493  Q
    |||||||| | ||||||||||||||  ||| ||||| | ||||||| ||||||||||||||    
50856404 tggcgcaacggtaaagttgttgtcacatgattgaaaggtcacgggttcaagtcctagaaac 50856344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 91; Significance: 9e-44; HSPs: 72)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 30395885 - 30395726
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||  || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
30395885 taaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 30395790  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
30395789 taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 30395726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 20004249 - 20004090
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||| ||||||||| || ||||    |||||||||| ||||||||||    
20004249 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggta----aggctgcgtacaatacaccaa 20004154  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||    
20004153 taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt 20004090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 32632713 - 32632557
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||| ||||||||| | ||||||| |||||||| ||||| | ||||||||||||||||||||    ||||||||||| ||||||||  |    
32632713 taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a 32632620  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||  |||| |||||||||||||||| ||||||||||||| ||||||    
32632619 aatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttcccttt 32632557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 34725253 - 34725098
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| ||||||| |||    
34725253 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacactaaa 34725159  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
34725158 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 34725098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 18944644 - 18944804
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||| ||| |||| ||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
18944644 taaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 18944739  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||| || ||||||||||| ||||||||||| |||||||||||    
18944740 caatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttt 18944804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 439 - 606
Target Start/End: Original strand, 27201643 - 27201807
Alignment:
439 aatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatac 537  Q
    |||| ||||||||||||||||||||||||| | || |||| |||||||| ||||| | ||||||||| | ||||||||||    |||||||||| |||||    
27201643 aatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta----aggctgcgtacaatac 27201738  T
538 accaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||||||||  || ||||||||||||||||||||   |||||||||||    
27201739 accaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgcccttt 27201807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 38478437 - 38478282
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||| |||||||||||||||||||| | ||||||| |||||||||||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
38478437 taaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 38478343  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      |||||| |||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||    
38478342 --tggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 38478282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 46248110 - 46247953
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||| | ||||| | |||||||||||||| |||||||    || ||||||| ||||||||||    
46248110 taaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa 46248015  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||| ||| |||||||||||    
46248014 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttt 46247953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 47214512 - 47214667
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| ||||||||| ||||| |||||||    ||| |||||| |||||||||||    
47214512 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaa-cagggta----aggttgcgtacaatacaccaaa 47214606  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||| ||||| ||||||||||||||| ||||||||||| || ||||||    
47214607 --tggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattacccttt 47214667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 14617039 - 14617196
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa-aacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | |||| || |||||||| ||||| | |||||||||||| ||||    ||| |||| |||||| ||||||||      
14617039 taaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataaca----aggtaaggttgcgtacaatacacc-- 14617132  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||| ||||||    
14617133 aaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttacccttt 14617196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 19414440 - 19414595
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||| ||||||||| | ||||||| |||||||||||||  | ||||| ||||||| |||| ||    |||||||||| |||||||||||    
19414440 taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaa-caggtta----aggctgcgtacaatacaccaaa 19414534  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      |||||||||||||||||| |||| ||||||||||||||| ||||||||| |||||||||||    
19414535 --tggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgcccttt 19414595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 27474282 - 27474438
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||| | ||||| ||||||||||||||||||||| |    | |||||||| |||||||  ||    
27474282 taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggca----aagctgcgtacaatacactgaa 27474377  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| || |||||||||||||||||||||| | |||||||||    
27474378 --tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 27474438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 457 - 606
Target Start/End: Original strand, 10668239 - 10668385
Alignment:
457 atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc 555  Q
    |||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| || ||||    ||| |||||| |||||||||| ||||||||||||    
10668239 atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggta----aggttgcgtacaatacaccaataatggtgggacc 10668334  T
556 ccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| ||| || |||||||||||||||||||||| |||||||||||    
10668335 ccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10668385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 433 - 586
Target Start/End: Original strand, 11596503 - 11596650
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||| | |||||| | |||||||||||||||| | ||||||| ||||||||||||||   ||||||||||||||||||||    |||||||||||     
11596503 tggcgcaacggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggt----aaggctgcgtat 11596598  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||||  ||||||||||||||||||| |||||| || ||||||||||||||    
11596599 aatacacc--aaatggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 459 - 606
Target Start/End: Original strand, 35005139 - 35005283
Alignment:
459 gtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccc 557  Q
    |||||||||| | ||||||| |||||| |  |||| | |||||||||||||| |||||||    ||||||| || |||||||||||||||||||||||||    
35005139 gtgactgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggta----aggctgcatacaatacaccaaaaatggtgggacccc 35005234  T
558 ttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| || |||||||| ||||||||||||| |||||||||||    
35005235 ttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgcccttt 35005283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 433 - 602
Target Start/End: Complemental strand, 45812704 - 45812541
Alignment:
433 tggcgcaa-tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgta 531  Q
    |||||||| |||||||||||||||||||||||||||| | ||| ||| ||||||||  |||| |||||||||||||||  ||||||    ||||||| ||    
45812704 tggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaag-agggta----aggctgcata 45812610  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
     |||||||||||  |||||||||||||||||  |||| ||||||||||||||| ||||||||| |||||||    
45812609 caatacaccaaa--tggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 457 - 606
Target Start/End: Complemental strand, 35253329 - 35253187
Alignment:
457 atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc 556  Q
    ||||||||||||   ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||  |||||||||||    
35253329 atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggaccc 35253237  T
557 cttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| ||||||||||||||| ||||||||| | |||||||||    
35253236 cttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttt 35253187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 533 - 606
Target Start/End: Original strand, 50606488 - 50606561
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||    
50606488 aatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt 50606561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 444 - 607
Target Start/End: Complemental strand, 35117925 - 35117764
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||| |||||||||| | ||||||| |||||||| ||||  | ||||||||||||| ||||||||    |||||| ||| ||||||||||    
35117925 taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggta----aggctgtgtacaatacaccaa 35117830  T
543 aaatggtgggaccccttcccggaccccgcat-atgcgggagctttagtgcaccaggttgccctttg 607  Q
    ||||| |||||||||||||||||||| || | |||| |||||||||||||||| || | |||||||    
35117829 aaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttccctttg 35117764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 444 - 603
Target Start/End: Original strand, 46991805 - 46991959
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| |||||   |||||||||||||| |||||||    |||||| ||| |||||||| |    
46991805 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccga 46991900  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    |  ||||||||||||||||||||||| || |||| ||||||||||||||||| ||||||||    
46991901 a--tggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 433 - 595
Target Start/End: Complemental strand, 18724713 - 18724557
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgta 531  Q
    |||||||| | ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||| ||||||||||    ||||||| |||    
18724713 tggcgcaacggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt----aaggctgtgta 18724618  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacca 595  Q
     ||||||||  ||||  ||||||||||||||||||||  |||||||||||||||| ||||||||    
18724617 caatacacc--aaatcttgggaccccttcccggaccctacatatgcgggagcttt-gtgcacca 18724557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 41319963 - 41319806
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||| |||  ||||||| ||||| |||||||||||| ||||||||||    ||||||||||| ||||||||      
41319963 taaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggt----aaggctgcgtacaatacacc-- 41319870  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||| ||||||||||||||| ||||  |||||||||||| || |||||||  |||||||||||    
41319869 aaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgcccttt 41319806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 18742118 - 18741957
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctag-aaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacc 540  Q
    ||||||||||||||||||||||||| | || |||| ||| || | | |||| |||| |||| ||||||  |||||||    |||||||||| ||||||||    
18742118 taaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggta----aggctgcgtacaatacacc 18742023  T
541 aaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||| ||||| || |||||| ||||||||||||||| |||| ||||||    
18742022 aaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttt 18741957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 4349713 - 4349796
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
4349713 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 4349796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 445 - 606
Target Start/End: Original strand, 9939463 - 9939622
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||||| | |||| || |||||||| |||||   ||||||| ||| ||||| ||||    ||| |||||  |||||||||||    
9939463 aaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggta----aggttgcgtgcaatacaccaaa 9939558  T
544 aatggtgggacccc-ttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||| ||| ||||||| || |||||||||||||||||||||| |||| ||||||    
9939559 aatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttacccttt 9939622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 444 - 603
Target Start/End: Original strand, 45402096 - 45402251
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaagg-ctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||| || || |  |||||| |||||||| ||||| | ||||||||||||||||||||    |||  ||||||| ||||||||||    
45402096 taaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttc--aagttctgcgtacaatacaccaa 45402192  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    |  ||||||||||||||||| ||||| || |||||||||||||||||||||| ||||||||    
45402193 a--tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 444 - 592
Target Start/End: Complemental strand, 23768477 - 23768334
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||| ||| |||||| | ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
23768477 taaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 23768382  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    |  ||||||||| ||||||| ||||| || ||||||||||||||||||||    
23768381 a--tggtgggacaccttcccagaccctgcgtatgcgggagctttagtgca 23768334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 594
Target Start/End: Original strand, 6925101 - 6925246
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||  | ||||||||||||||     ||||| ||||||||| | |||||||| |    
6925101 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaa----tagggtaaggctgcggacaatacaccga 6925196  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |  ||||||||||||||||||| ||| || ||||||||||||||||||||||    
6925197 a--tggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcacc 6925246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 521 - 604
Target Start/End: Complemental strand, 19932838 - 19932755
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||| || |||||  || | ||||||||||||||||||||    
19932838 aaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct 19932755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 12126992 - 12126837
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||| | ||||| | |||||||  |||| || ||||| |  |||||||||||| |||||||    |||||||||| |||||||||||    
12126992 taaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 12126898  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      | ||||||||||||||||||||| ||||||||||||||| ||||||||   ||||||||||    
12126897 --ttgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgcccttt 12126837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 484 - 606
Target Start/End: Complemental strand, 31382330 - 31382214
Alignment:
484 tcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagc 583  Q
    |||| ||||| | |||||||||||||||||| ||    |||||||||| |||||||||||  |||||||||||||||| |||||| ||||||||||||||    
31382330 tcctggaaacagcctcttgtgtaaaaacaggata----aggctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcatatgcgggagc 31382237  T
584 tttagtgcaccaggttgcccttt 606  Q
    |||| || ||| |||||||||||    
31382236 tttactgtaccgggttgcccttt 31382214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 433 - 594
Target Start/End: Complemental strand, 2435955 - 2435798
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||||||| |||||||||| | ||||||| |||||||| ||||| | ||| ||||| ||||| |||||    ||| |||||||    
2435955 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggt----aagcctgcgta 2435860  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
     |||||||| |||||||||||||||||| ||| ||||  |  |||||||||||||||||||||    
2435859 caatacacc-aaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcacc 2435798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 444 - 611
Target Start/End: Original strand, 19701571 - 19701734
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||| ||||||||||| | |||||||  ||||| |  |||| | ||||||||||||||     | || |||| || ||| |||||||||||    
19701571 taaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaac---ttggtaaggatgggtacaatacaccaaa 19701667  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    | ||||||| ||||||||||||||| || ||||||||||||||||||||||||| | |||||| ||||    
19701668 a-tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctacccttttttta 19701734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 42304292 - 42304207
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||| |||||| ||||||| |||||||||||||||||||||||||||| || |||| ||||||||||||||||| | |||||||||    
42304292 aaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttt 42304207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 475 - 604
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
475 gggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcata 574  Q
    |||| |||||| | ||||| | |||||||||||||||||||||    ||||||| || |||||||||||||||||||  |||| ||||| |||| || ||    
22324925 gggttcaagtcttggaaacagcctcttgtgtaaaaacagggta----aggctgcatacaatacaccaaaaatggtggagccccgtcccg-accctgcgta 22325019  T
575 tgcgggagctttagtgcaccaggttgccct 604  Q
    ||||||||||||||||||||||| ||||||    
22325020 tgcgggagctttagtgcaccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 446 - 612
Target Start/End: Original strand, 8197046 - 8197207
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    ||||||||||||||||||||||| | ||||||| |||||||| | ||  | |||||||||||||| || ||||    ||||| |||| | |||||||||     
8197046 aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta----aggctacgtacagtacaccaaa- 8197140  T
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttat 612  Q
     |||| |||||||||| ||||||| || ||||  |||||||||||| ||| ||||||||||| |||||    
8197141 -tggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttttttat 8197207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 521 - 603
Target Start/End: Complemental strand, 10378818 - 10378738
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    ||||||||||| |||||||||||  |||||||||||||||  |||||| ||||||||||||||||||||||||| || |||||    
10378818 aaggctgcgtacaatacaccaaa--tggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc 10378738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 433 - 606
Target Start/End: Complemental strand, 6983977 - 6983811
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||||| |||||||||||||| |||||||||| | ||| ||| |||||||| ||||| | ||| | |  |||||||||||| | |    ||||||     
6983977 tggcgcaatggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcgtata-aaaaacagggtaagta----tgcgtac 6983883  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||  |||||||||||||| |||||||| || || || |||||||| ||||||| || ||||||||    
6983882 aatacaccaaa--tggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgcccttt 6983811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 433 - 508
Target Start/End: Original strand, 20036210 - 20036285
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa 508  Q
    |||||||||| ||||||||||||||||||||||||| | ||||||| |||||||| |||||   ||||||||||||    
20036210 tggcgcaatggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaa 20036285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 521 - 611
Target Start/End: Original strand, 23796540 - 23796628
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||| |||||| |||||||||||  ||||| ||||||||||| ||||| |||||||| |||||||||||||||| || |||||||| ||||    
23796540 aaggttgcgtacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgcccttttttta 23796628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 1517394 - 1517311
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| ||||||||||   ||||||||||||||| | ||||| || ||||| |||||||||||||||| |||||||||||    
1517394 aaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgcccttt 1517311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 543 - 601
Target Start/End: Complemental strand, 4587626 - 4587568
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgc 601  Q
    |||||||||||||||||||||||||| || ||||||||||||| |||||||| ||||||    
4587626 aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc 4587568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 433 - 604
Target Start/End: Complemental strand, 15511319 - 15511150
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcg-- 529  Q
    |||||||||| |||||||||||| ||||| |||||| | |||   |  ||||||| ||||| | |||||||||||||| |||||||    ||||||||      
15511319 tggcgcaatggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggta----aggctgcgga 15511224  T
530 taaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    || |||||||||||| |||||| ||||||||| |||||| || |||| | ||||||||||||||| || ||||||    
15511223 tacaatacaccaaaa-tggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct 15511150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 561
Target Start/End: Complemental strand, 17470503 - 17470390
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||| |||||||||  | || |||| |||||||||||||| | |||||||||| ||||||||||    ||||||||||| |||||||| |    
17470503 taaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggt----aaggctgcgtacaatacacc-a 17470409  T
543 aaatggtgggaccccttcc 561  Q
    |||| ||||||||| ||||    
17470408 aaatagtgggacccgttcc 17470390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 517
Target Start/End: Complemental strand, 22930224 - 22930151
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta 517  Q
    ||||||||||||||||||||||||| | || |||| |||||||| ||||| | || ||||||||||||||||||    
22930224 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggta 22930151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 576
Target Start/End: Original strand, 25290164 - 25290300
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaa--acggtctcttgtgt-aaaaacagggt-agggaaggctgcgtaaaatacac 539  Q
    ||||||||||||||||||||||||| | |||| || |||||| | |||  || | ||||||||| ||||||||||| ||| |||| || ||| |||||||    
25290164 taaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaaggcaaggttgtgtacaatacac 25290263  T
540 caaaaatggtgggaccccttcccggaccccgcatatg 576  Q
    |||||||| | |||||||||||| ||| | |||||||    
25290264 caaaaatgataggaccccttcccagactctgcatatg 25290300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 444 - 584
Target Start/End: Complemental strand, 25468420 - 25468285
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||| ||||| | || |||| |||||||| |||||   |||||||||||||| ||||||    |||| |||||| ||||||||      
25468420 taaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggt----aaggttgcgtacaatacacc-- 25468327  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagct 584  Q
    ||||||| ||||| |||||| ||||| || ||||||||||||    
25468326 aaatggttggacctcttcccagaccctgcgtatgcgggagct 25468285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 533 - 594
Target Start/End: Complemental strand, 45264471 - 45264411
Alignment:
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    |||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||||    
45264471 aatacaccaaaa-tggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 444 - 557
Target Start/End: Original strand, 33222985 - 33223093
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||| |  ||||| | ||||| | |||||||||||||||||    || |||| |||||| |||||||| ||    
33222985 taaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacag----ggaaaggttgcgtacaatacacc-aa 33223079  T
544 aatggtgggacccc 557  Q
    ||||||||||||||    
33223080 aatggtgggacccc 33223093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 551 - 606
Target Start/End: Original strand, 16120819 - 16120874
Alignment:
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||| ||| |||||||||||||||||| ||||||||| ||||||||    
16120819 ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttt 16120874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 433 - 606
Target Start/End: Original strand, 50811929 - 50812098
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt--aaaaacagggtagggaaggctgcgt 530  Q
    |||||||| | |||||||||||||| |||||||||| | |||||   || ||||| ||||| |  ||||||||  |||||||||||    |||| |||||    
50811929 tggcgcaacggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggt----aaggttgcgt 50812024  T
531 aaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | |||||||| |||||||| |||||||||||||  ||| || ||||||||||||||| |||||  || ||||||||    
50812025 acaatacacc-aaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttt 50812098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 543 - 611
Target Start/End: Original strand, 30555210 - 30555278
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||||||||||||||| ||||||| || |||||| ||||||||||||||| || || ||||| ||||    
30555210 aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttttttta 30555278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 546 - 593
Target Start/End: Complemental strand, 33594191 - 33594144
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    ||||||||||||||||| ||||| || |||||||||||||||||||||    
33594191 tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac 33594144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 444 - 586
Target Start/End: Complemental strand, 44485266 - 44485129
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||| ||||| | |||||||   |||||| |||||   | ||||||||||| ||| ||||    |||||||||| ||||||||||    
44485266 taaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggta----aggctgcgtacaatacaccaa 44485171  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    |  |||| ||||||||||||||| ||  | ||||||||||||||    
44485170 a--tggttggaccccttcccggatcctacgtatgcgggagcttt 44485129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 525 - 586
Target Start/End: Original strand, 15505643 - 15505702
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    ||||||| |||||||||||  |||||||||||||||||| |||| || ||||||||||||||    
15505643 ctgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcgggagcttt 15505702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 556 - 606
Target Start/End: Complemental strand, 19386626 - 19386576
Alignment:
556 ccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||| ||||||||||||||| ||||| |||||||||| ||||    
19386626 ccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctcttt 19386576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 20999933 - 20999850
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  || |||| |||||||| | |||| || || ||||||||||||||||||| || ||||||||    
20999933 aaggctgcgtacaatacaccaaa--tgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgcccttt 20999850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 599
Target Start/End: Complemental strand, 31442473 - 31442396
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggtt 599  Q
    |||| |||||| |||||||||||| ||||||||||||||||||||| | |  |||| ||||||||| ||||||| ||||    
31442473 aaggatgcgtacaatacaccaaaa-tggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt 31442396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 43768214 - 43768297
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||| || ||||||||||   ||||||||||||||||| ||||| || ||| ||||||||||| |||||| || ||||||||    
43768214 aaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttt 43768297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 445 - 510
Target Start/End: Original strand, 22327101 - 22327166
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||||||||||||||| | | ||||| |||||||| |||||   ||||||||||||||    
22327101 aaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaa 22327166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 543 - 600
Target Start/End: Original strand, 30682907 - 30682963
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttg 600  Q
    |||||||||||||||||||||||||  || |||||||||||||| |||||||| ||||    
30682907 aaatggtgggaccccttcccggaccgtgcgtatgcgggagcttt-gtgcaccaagttg 30682963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 433 - 542
Target Start/End: Complemental strand, 50760394 - 50760288
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgta 531  Q
    |||||||| | |||||| |||||||||||||||| | | ||||||| ||||||||  |||| | |||||||||| ||||| ||||    |||||||||||    
50760394 tggcgcaaaggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggt----aaggctgcgta 50760299  T
532 aaatacaccaa 542  Q
     ||||||||||    
50760298 taatacaccaa 50760288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 542 - 597
Target Start/End: Original strand, 1693220 - 1693276
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccagg 597  Q
    ||||||||||||||||||||| ||||| ||| |||| ||||| ||||||||||||||    
1693220 aaaatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcaccagg 1693276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 523 - 595
Target Start/End: Original strand, 7074593 - 7074664
Alignment:
523 ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacca 595  Q
    ||||||||| |||||||||||| || ||||||| ||| |  ||||| |||||| |||||||||||||||||||    
7074593 ggctgcgtacaatacaccaaaattg-tgggacctctttctagaccctgcatatccgggagctttagtgcacca 7074664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 547 - 586
Target Start/End: Complemental strand, 20169148 - 20169109
Alignment:
547 ggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
    |||||||| ||||||||||||| |||||||||||||||||    
20169148 ggtgggactccttcccggaccctgcatatgcgggagcttt 20169109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 433 - 520
Target Start/End: Complemental strand, 25554890 - 25554803
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg 520  Q
    |||||||||| |||||||||||||| |||||| ||| | |||| ||  ||||||| |||||   |||||||||| ||||| |||||||    
25554890 tggcgcaatggtaaagttgttgtcacgtgactaaaaggccacgtgtttaagtcctggaaacaacctcttgtgtagaaacacggtaggg 25554803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 487
Target Start/End: Original strand, 40424743 - 40424786
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcct 487  Q
    ||||||||||||||||||||||||| | ||||||| ||||||||    
40424743 taaagttgttgtcatgtgactgaaaggccacgggttcaagtcct 40424786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 444 - 510
Target Start/End: Complemental strand, 2436050 - 2435984
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||||| |||||||||| | ||||||| |||||||| |||||   ||| ||||||||||    
2436050 taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaa 2435984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 524 - 590
Target Start/End: Original strand, 6358199 - 6358264
Alignment:
524 gctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 590  Q
    |||||||| || ||||||||| ||||||||||||||||| ||||| || ||||| ||| ||||||||    
6358199 gctgcgtacaaaacaccaaaa-tggtgggaccccttcccagaccctgcgtatgcaggatctttagtg 6358264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 553 - 603
Target Start/End: Complemental strand, 28894611 - 28894561
Alignment:
553 accccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    |||||||||  ||||| ||||||||| |||||||||||||||||| |||||    
28894611 accccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc 28894561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 19974158 - 19974074
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||| |||||| |||||||||||| || |||||||| ||||||||| |    |||||||||||||||||||||  || ||||||||    
19974158 aaggttgcgtacaatacaccaaaa-tgatgggacccattcccggactctatgtatgcgggagctttagtgcacggggctgcccttt 19974074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 613
Target Start/End: Original strand, 35019305 - 35019394
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttatt 613  Q
    |||||||| || ||||||||||   ||||||||||||| ||| ||||| || |||||| ||||||||||||||| || |||| ||| ||||||    
35019305 aaggctgcatacaatacaccaat--tggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgggctgccatttttttatt 35019394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 87; Significance: 2e-41; HSPs: 51)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 7136686 - 7136527
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaac-agggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | || |||| |||||||| |||||   ||||||||||||||| ||||||    |||||||||| ||||||||||    
7136686 taaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggta----aggctgcgtacaatacaccaa 7136591  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||    
7136590 taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttacccttt 7136527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 13160680 - 13160836
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||||||||||| | ||||||||||||||||||||    ||||||||||| ||||||||  |    
13160680 taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a 13160773  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||||||||||||||||| || ||||||||||||| ||||| || |||||||||||    
13160774 aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt 13160836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 444 - 611
Target Start/End: Original strand, 6760800 - 6760964
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||| |||||  || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    ||||| |||| ||||||||||    
6760800 taaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggcttcgtacaatacaccaa 6760895  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
     ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||    
6760896 taatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgcccttttttta 6760964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 12670405 - 12670250
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||||    |||||||||| |||||||||||    
12670405 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa 12670311  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||| ||||||    
12670310 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttacccttt 12670250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 39461153 - 39460994
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||| |||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||| |||    |||||||||| ||||||||||    
39461153 taaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta----aggctgcgtacaatacaccaa 39461058  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||||| ||||||||||||||||| || |||||||||||||||||||||| |||||||||||    
39461057 taatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 39460994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 36720774 - 36720931
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| ||||||||||    
36720774 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 36720869  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || ||||||| |||||||||||||| |||||||||||    
36720870 a--tggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgcccttt 36720931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 30454252 - 30454097
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| || ||||    ||||||||||  ||||||||||    
30454252 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-caaggta----aggctgcgtacgatacaccaaa 30454158  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
30454157 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30454097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 444 - 600
Target Start/End: Complemental strand, 21070859 - 21070703
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| |     || ||||||||||| ||||||||||     
21070859 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaat 21070760  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttg 600  Q
    ||||||||||||||||||||||||| || |||||||||| ||||||||||| |||||    
21070759 aatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 21070703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 26954110 - 26954270
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||||||||| |  || | ||||||| |||||||| ||||| | ||||||||||||||  |||||||    |||||||||| |||||||||    
26954110 taaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta----aggctgcgtacaatacacca 26954205  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    | ||||||||||||||||||| |||| |||||||||||||||||||||||||  |||||||||||    
26954206 ataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgcccttt 26954270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 28817783 - 28817626
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| |||||||    |||||||||| |||||||| |    
28817783 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccca 28817688  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||||| | |||||||||||    
28817687 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttt 28817626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 35261657 - 35261814
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| |||| ||| ||||| |||||||||||||||| |||||||    ||| |||||| ||||||||||    
35261657 taaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa 35261752  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||||||||||||| |||||| || |||||||||||||||||||||| |||||||||||    
35261753 a--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 35261814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 444 - 600
Target Start/End: Complemental strand, 20284230 - 20284075
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| |    |||| ||||||||||| ||||||||||    
20284230 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaa--agggtaaggctgcgtacaatacaccaa 20284133  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttg 600  Q
     ||||||||||||||||||||||||| || |||||||||| ||||||||||| |||||    
20284132 taatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 20284075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 484 - 606
Target Start/End: Original strand, 20869941 - 20870060
Alignment:
484 tcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggag 582  Q
    |||| ||||| |||||||||||||||| |||||||    |||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||    
20869941 tcctggaaacagtctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggag 20870036  T
583 ctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| |||||||||||    
20870037 ctttagtgcaccgggttgcccttt 20870060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 444 - 605
Target Start/End: Original strand, 45071243 - 45071398
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||| || || | ||||||| ||||| || ||||| | |||||||||||||||||||||    |||||||||| |||||||||||    
45071243 taaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa 45071338  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
      ||||||||||||||||||||||  || ||||||||||||| |||||||| ||||||||||    
45071339 --tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 17823554 - 17823711
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaac-agggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||| |||| | ||||||| |||||||| ||||| | ||||||||||||||| ||| ||    || ||||||||||||||||||    
17823554 taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggata----agactgcgtaaaatacaccaa 17823649  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||| ||||||||||| |||| |||||||| |||||||||||||||| |||||||||||    
17823650 a--tggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttt 17823711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 25250500 - 25250659
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaa-ggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | |||  || |||||||| ||||| | || |||||||||||     ||||| | ||||||||| ||||||||||    
25250500 taaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaa----tagggtatggctgcgtacaatacaccaa 25250595  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
     |||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||    
25250596 taatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttt 25250659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 444 - 607
Target Start/End: Original strand, 2626497 - 2626658
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||| |||| | ||||||| |||||||| ||||| | |||||||||||||| |     || ||| ||||||| |||||||||||    
2626497 taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaa 2626596  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
      || |||||||||||||| ||||| |||||||||||||||| |||||||||| ||||||||||    
2626597 --tgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccctttg 2626658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 446 - 602
Target Start/End: Complemental strand, 18164914 - 18164764
Alignment:
446 aagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa 545  Q
    ||||||||||||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||||||||||    ||| |||||| |||||||||||      
18164914 aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaag- 18164820  T
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
     | || ||||  ||||||||||| || |||||||||||||||||||||| |||||||    
18164819 -gatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 18164764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 433 - 607
Target Start/End: Complemental strand, 29521854 - 29521684
Alignment:
433 tggcgcaa-tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgt 530  Q
    |||||||| |||||||||||||||| |||||||| || | ||||||| |||||||| ||||| | ||||||| |||||| |||||||    |||||||||    
29521854 tggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggta----aggctgcgt 29521759  T
531 aaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    | |||||||||||  |||||||| ||| |||| ||||| || |||||||||||||||||||||| |||||| |||||    
29521758 acaatacaccaaa--tggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctctttg 29521684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 433 - 593
Target Start/End: Complemental strand, 44781674 - 44781517
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgta 531  Q
    |||||||| | |||||||||||||| ||||||||||   ||||||| |||||||| |||||   ||||||||||||| ||||||||    |||||| |||    
44781674 tggcgcaacggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggta----aggctgtgta 44781579  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
     ||||||||||||||| ||||||||| |||| ||||| || |||||||||||||||||||||    
44781578 caatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 525 - 606
Target Start/End: Original strand, 16225075 - 16225156
Alignment:
525 ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||    
16225075 ctgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtccttt 16225156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 8897921 - 8897764
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||| | || | |||||||  ||||||| |||||   | ||||||||||||     ||||| |||||| |||| ||||||||||    
8897921 taaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaa----tagggtaaggctacgtacaatacaccaa 8897826  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||    
8897825 a--tggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgcccttt 8897764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 44530127 - 44530284
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||| ||||||||||||  || | ||||||| |||||| | |||||   |||||||||||||| |||||||    |||||||||| ||||||||||    
44530127 taaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa 44530222  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||||||||||||| |||||| || |||||||||||||||||||||| ||||| |||||    
44530223 a--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgaccttt 44530284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 444 - 583
Target Start/End: Complemental strand, 20869653 - 20869523
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||| ||||||||||    ||||||| ||| ||||||||||     
20869653 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggt----aaggctgtgtacaatacaccaa- 20869560  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagc 583  Q
       |||| ||||||||||||||||| ||||||||||||||    
20869559 ---ggtgagaccccttcccggaccctgcatatgcgggagc 20869523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 444 - 586
Target Start/End: Complemental strand, 24365217 - 24365079
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||||||||||| ||| | ||||||| |||| ||||||||| | ||||||||||||||  ||||||    ||||||||| | ||||||||     
24365217 taaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggt----aaggctgcgaacaatacacc- 24365123  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagcttt 586  Q
     |||||||||||||||||||||||||| || |||| |||||||||    
24365122 -aaatggtgggaccccttcccggaccctgcgtatgtgggagcttt 24365079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 521 - 604
Target Start/End: Original strand, 29877146 - 29877227
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| || ||||||||||| ||||||||||||| ||||||    
29877146 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 12625867 - 12626025
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca 541  Q
    ||||||||||||| |||||||   | | ||||||  |||||||| |||||   ||||||||||||||  |||||||    || |||| || |||||||||    
12625867 taaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggta----agactgcatacaatacacca 12625962  T
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||  |||||||||||| |||||||||| || |||||||||||||||||||||| |||||||||||    
12625963 aa--tggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 12626025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 526 - 606
Target Start/End: Original strand, 16013511 - 16013591
Alignment:
526 tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||| ||||||| |||||||||| ||||||||||| ||||| || |||||||||||||||||||||| ||||| |||||    
16013511 tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttt 16013591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 543 - 611
Target Start/End: Original strand, 26102589 - 26102657
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgttta 611  Q
    |||||||||||||||||||||||||| || |||||||||||| ||||||||| ||||||||||| ||||    
26102589 aaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttttttta 26102657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 444 - 607
Target Start/End: Original strand, 28407394 - 28407539
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||||||||||||||| || | ||||||| |||||||| ||||| | ||||||||||||||||||||| ||                ||||  |    
28407394 taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaagg----------------cacc--a 28407475  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    |||||||||||||||||||||||||  | ||||||||||||||| |||||| ||||||||||||    
28407476 aatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccctttg 28407539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 444 - 587
Target Start/End: Original strand, 24245429 - 24245565
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacc-aa 542  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| ||||||| |||   ||||||||    ||| || |||| ||| |||| ||    
24245429 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt---aacagggt----aagactacgtacaatgcaccaaa 24245520  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagcttta 587  Q
    |||| |||||||||||||| |||||| || |||||||||||||||    
24245521 aaattgtgggaccccttcctggaccctgcgtatgcgggagcttta 24245565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 433 - 592
Target Start/End: Complemental strand, 42083867 - 42083712
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa 532  Q
    |||||||| | |||| ||||||||| |||||||||| | ||||||| |||||||| ||||| | || |||||||||||  ||   || |||||||||||     
42083867 tggcgcaacggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatgg---ggcaaggctgcgtac 42083771  T
533 aatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 592  Q
    | || ||| |||||||||||||||||||||| |||| |  || | |||||||||||||||    
42083770 agtatacc-aaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgca 42083712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 472 - 606
Target Start/End: Complemental strand, 5135418 - 5135290
Alignment:
472 cacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgc 571  Q
    ||||||| |||||||| ||||| | |||||||||||||| || |  || ||||||| ||| |||||||||||  ||||||||||||||||||||||| ||    
5135418 cacgggttcaagtcctggaaacagcctcttgtgtaaaaa-agag--ggtaaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgc 5135324  T
572 atatgcgggagctttagtgcaccaggttgcccttt 606  Q
     ||||| |||||||| ||||||| || ||||||||    
5135323 gtatgcaggagcttt-gtgcaccgggctgcccttt 5135290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 19729392 - 19729475
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||| ||| |||||||||||  ||||||||||||||||||||||| |||||| |||||||| ||||||||  | |||||||||    
19729392 aaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcccttt 19729475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 448 - 606
Target Start/End: Original strand, 31457155 - 31457307
Alignment:
448 gttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatg 547  Q
    |||||||||||||| |||||| | ||||||| ||||||||  ||||   |||||||||||||| |||  |    |||||||||| |||||| ||||  ||    
31457155 gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaa----aggctgcgtacaatacatcaaa--tg 31457248  T
548 gtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    || ||||||||||||  |||| || |||||||||||| ||||||||| | |||||||||    
31457249 gtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcccttt 31457307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 452 - 606
Target Start/End: Complemental strand, 23000365 - 23000228
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgg 551  Q
    ||||||||||||||||| | |||||||  ||||||| ||||| | |||||||||||||||| |||    |||| | | || ||||||||  |||||||||    
23000365 ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggt----aaggttccatacaatacacc--aaatggtgg 23000274  T
552 gaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||         ||||||||||||||||||||| |||||||||||    
23000273 gaccccttcccgg---------atgcgggagctttagtgcaccgggttgcccttt 23000228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 546 - 605
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
546 tggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    |||||||||||||||||| |||| || |||||||||||||||||||||| ||||| ||||    
27507985 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt 27508044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 543 - 606
Target Start/End: Complemental strand, 35107374 - 35107311
Alignment:
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||||||||||||||| | |  ||||||| |||||||||||||| |||||||||||    
35107374 aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt 35107311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 10857881 - 10857964
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||| | ||||||||||   |||||||||| ||||| |||||  || |||||||||||||||||||||| |||||||||||    
10857881 aaggctgcgcacaatacaccaat--tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcccttt 10857964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 557 - 606
Target Start/End: Complemental strand, 27468141 - 27468092
Alignment:
557 cttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| || |||||||||||||||||||||| |||||||||||    
27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 27468092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 521 - 562
Target Start/End: Original strand, 43942376 - 43942417
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttccc 562  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
43942376 aaggctgcgtacaatacaccaaaaatggtgggaccccttccc 43942417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 449 - 577
Target Start/End: Original strand, 11748282 - 11748407
Alignment:
449 ttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatg 547  Q
    |||||||||||||||||||| | ||||||| |||||| | ||||| | ||||| |||||||| |||||||    || | ||||| |||| || |||||||    
11748282 ttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggta----agacagcgtacaatatacaaaaaatg 11748377  T
548 gtgggaccccttcccggaccccgcatatgc 577  Q
    || ||||||||||||| | || ||||||||    
11748378 gtaggaccccttcccgaatcctgcatatgc 11748407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 521 - 593
Target Start/End: Complemental strand, 17250960 - 17250888
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac 593  Q
    ||||| ||||| |||||||||| ||||||||||||| |||||| |||| || ||||  |||||||||||||||    
17250960 aaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac 17250888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 594
Target Start/End: Original strand, 5689683 - 5689754
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||||||  |||||| ||||||||||| |||  || |||| |||||||||||||||||    
5689683 aaggctgcgtacaatacaccaaa--tggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcacc 5689754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 594
Target Start/End: Complemental strand, 8484021 - 8483950
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| ||||||||||   |||||||||||| |||| ||||| || |||||||||||||||| |||||    
8484021 aaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcgtatgcgggagctttagggcacc 8483950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 603
Target Start/End: Complemental strand, 44742602 - 44742521
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    ||||||||||| |||||||||||| |||||||||||||||  ||||||  |  |||||||||| |||||||||| || |||||    
44742602 aaggctgcgtacaatacaccaaaa-tggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc 44742521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 433 - 585
Target Start/End: Complemental strand, 14018137 - 14017989
Alignment:
433 tggcgcaatgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgta 531  Q
    |||||||| | ||| |||||||||| |||| ||||| | || |||| |||||| | ||||| |||||||||||| ||||||||||     || |||||||    
14018137 tggcgcaacggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggt----gagactgcgta 14018042  T
532 aaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctt 585  Q
     |||||| | ||| |||||||||| ||||| |||||| ||| |||||| |||||    
14018041 caataca-ctaaattggtgggaccacttcctggaccctgcagatgcggtagctt 14017989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 445 - 568
Target Start/End: Original strand, 35105902 - 35106021
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa 544  Q
    ||||||||||||| ||| |||||| | ||||||| |||||||| |||||   ||||||||| |||| || ||  | ||||||||||| |||||||| | |    
35105902 aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgt-aaaagagagt--gtaaggctgcgtacaatacacc-aga 35105997  T
545 atggtgggaccccttcccggaccc 568  Q
    ||||||||||| ||||| ||||||    
35105998 atggtgggacctcttcctggaccc 35106021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 545 - 605
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
545 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctt 605  Q
    ||||||||||| |||||||||||  || ||||| ||||||||||||| || ||||||||||    
36486627 atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt 36486567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 539 - 602
Target Start/End: Original strand, 18595906 - 18595969
Alignment:
539 ccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcc 602  Q
    ||||||||| | |||||||||||||||||| |  |||||||||| ||||||||| | |||||||    
18595906 ccaaaaatgataggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc 18595969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 445 - 510
Target Start/End: Complemental strand, 30962929 - 30962864
Alignment:
445 aaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    |||||||||||||||||| ||||| | ||||  | |||||||| ||||| | ||||||||||||||    
30962929 aaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaa 30962864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 83; Significance: 5e-39; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 30557 - 30712
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||||||    ||||||| |||||||||||    
30557 taaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaa-cagggtaggg----ctgcgtacaatacaccaaa 30651  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
30652 --tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 30712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 71; Significance: 8e-32; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 13180 - 13024
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||| ||| |||||||| ||||| | |||||| ||||||||| ||||    |||||||||| |||||||| ||    
13180 taaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggta----aggctgcgtacaatacaccgaa 13085  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||||||||||| ||||| || |||||||| ||||||||||||| |||||||||||    
13084 --tggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttt 13024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 71; Significance: 8e-32; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 452 - 606
Target Start/End: Original strand, 58963 - 59114
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtg 550  Q
    ||||||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| |||||||    || ||||||| ||||||||||||||||||    
58963 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----agactgcgtacaatacaccaaaaatggtg 59058  T
551 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |||||||||||| ||| | || |||||||||||||||||||| | |||||||||||    
59059 ggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt 59114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 66; Significance: 8e-29; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 444 - 613
Target Start/End: Complemental strand, 1742 - 1580
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | || |||| ||||||||  ||||   ||||||||||||| |||| ||    ||||||| || |||||||||||    
1742 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaa-caggata----aggctgcatacaatacaccaaa 1648  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttatt 613  Q
      || |||||||||||||||||||| || |||||||||||||||||||||||||||||| ||| ||||||    
1647 --tgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgccttttatttatt 1580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 66; Significance: 8e-29; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 444 - 612
Target Start/End: Original strand, 46809 - 46972
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||  || | ||||||| ||||| || |||||   ||||||||||||||     ||||| |||| |||||| ||||||||||    
46809 taaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaa----tagggtaaggttgcgtacaatacaccaa 46904  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccctttgtttat 612  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||| |||||    
46905 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttttat 46972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Complemental strand, 24924 - 24772
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    ||||||||||||||||||||||||| | || |||| ||||||     ||| | |||||||||||||| |||||||    |||||||||| || |||||||    
24924 taaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggta----aggctgcgtacaacacaccaa 24834  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  |||||||||||||||||| |||| || |||||||||||||||||||| | |||||||||||    
24833 a--tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcccttt 24772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 521 - 606
Target Start/End: Original strand, 43709 - 43793
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcc-cggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  |||||||||||||| | ||||||| ||||||||||||||| ||||||||   ||||||||||    
43709 aaggctgcgtacaatacaccaaa--tggtgggacccctttctcggaccctgcatatgcgggagctctagtgcactgagttgcccttt 43793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 542 - 603
Target Start/End: Complemental strand, 46771 - 46710
Alignment:
542 aaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccc 603  Q
    ||||||||||||||||||||| ||||| || ||||||||||||||| |||| |||| |||||    
46771 aaaatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgcatcaggctgccc 46710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 65; Significance: 3e-28; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 444 - 604
Target Start/End: Complemental strand, 10205 - 10052
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||| |||    || ||||||| |||||||||||    
10205 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagagta----agactgcgtacaatacaccaaa 10111  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
     |  ||||||||||||||||||||| |||||||| ||||||  |||||||| |||||||||    
10110 ta--gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 10052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 444 - 604
Target Start/End: Complemental strand, 20533 - 20380
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    ||||||||||||||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||| |||    || ||||||| |||||||||||    
20533 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagagta----agactgcgtacaatacaccaaa 20439  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgccct 604  Q
     |  ||||||||||||||||||||| |||||||| ||||||  |||||||| |||||||||    
20438 ta--gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct 20380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 63; Significance: 5e-27; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 11110 - 11264
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa 543  Q
    |||||||||| | |||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||  |||    ||||||| || |||||||||||    
11110 taaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-caaagta----aggctgcttacaatacaccaaa 11203  T
544 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
      ||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||    
11204 --tggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttt 11264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 48717 - 48634
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||    
48717 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 48634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 56; Significance: 7e-23; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 444 - 606
Target Start/End: Original strand, 10788 - 10945
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||||||||||||| || | ||||||| ||||  ||  ||||   |||||||||||||| ||||||||||    ||||||  ||||||||||    
10788 taaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtaggg----ctgcgtccaatacaccaa 10883  T
543 aaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    |  ||||||||||||||||||||||| || |||||||||||||||||||||  |||||| ||||    
10884 a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctcttt 10945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 55; Significance: 3e-22; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 521 - 606
Target Start/End: Complemental strand, 24216 - 24133
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccaggttgcccttt 606  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||| ||||||||||||||| ||||||||| | |||||||||    
24216 aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttt 24133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 472 - 607
Target Start/End: Complemental strand, 72997 - 72866
Alignment:
472 cacgggtccaagtcctagaaacg-gtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggacccc 569  Q
    ||||||| ||||||||||||||  |||||||||||||||| || ||||    ||||||| || |||||||||||  |||| | ||||||||||||| ||     
72997 cacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggta----aggctgcctacaatacaccaaa--tggtagtaccccttcccggaacct 72904  T
570 gcatatgcgggagctttagtgcaccaggttgccctttg 607  Q
    || |||||||||||||||||||||||||||||||||||    
72903 gcgtatgcgggagctttagtgcaccaggttgccctttg 72866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 444 - 568
Target Start/End: Original strand, 4135 - 4257
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa 542  Q
    |||||||||||| |||||||||||| | ||||||| |||||||| |||||   ||||||||||||| ||||| |    |||| |||||| ||||||||||    
4135 taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggat----aaggttgcgtacaatacaccaa 4230  T
543 -aaatggtgggaccccttcccggaccc 568  Q
     || |||||||||||||||||||||||    
4231 taattggtgggaccccttcccggaccc 4257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 444 - 510
Target Start/End: Complemental strand, 226563 - 226497
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa 510  Q
    ||||||||||||||||||||||||| | ||||| | |||||||||||||| | ||||||| ||||||    
226563 taaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaa 226497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 594
Target Start/End: Original strand, 3596 - 3667
Alignment:
521 aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc 594  Q
    ||||||||||| |||||||| ||  || ||||||||||||||| |||| || ||||||| ||||||||||||||    
3596 aaggctgcgtataatacaccgaa--tgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcacc 3667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 444 - 513
Target Start/End: Original strand, 43107 - 43176
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacag 513  Q
    ||||||| ||||||||||| ||||| | |||| || || ||||||||||| | |||||||||||||||||    
43107 taaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaacag 43176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 452 - 561
Target Start/End: Complemental strand, 35167 - 35062
Alignment:
452 ttgtcatgtgactgaaacgacacgggtccaagtcctagaaacggtctctt--gtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggt 549  Q
    |||||||||||||| || | ||||||| ||||||||  |||| |||||||  |||| ||||||||||    ||||||||||| ||||||||  |||||||    
35167 ttgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggt----aaggctgcgtacaatacacc--aaatggt 35074  T
550 gggaccccttcc 561  Q
    ||||||| ||||    
35073 gggaccctttcc 35062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 485
Target Start/End: Original strand, 83853 - 83894
Alignment:
444 taaagttgttgtcatgtgactgaaacgacacgggtccaagtc 485  Q
    ||||||||||||||||||||||||| | ||||||| ||||||    
83853 taaagttgttgtcatgtgactgaaaggtcacgggttcaagtc 83894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 615 - 643
Target Start/End: Original strand, 6452 - 6480
Alignment:
615 atgaaaaggcttcgtctcattcttctcat 643  Q
    |||||||||||||||||||||||||||||    
6452 atgaaaaggcttcgtctcattcttctcat 6480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 441 - 493
Target Start/End: Original strand, 24639 - 24691
Alignment:
441 tgataaagttgttgtcatgtgactgaaacgacacgggtccaagtcctagaaac 493  Q
    ||||||||||||||||| ||||||| || | ||||||| |||||||| |||||    
24639 tgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaac 24691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University