View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8826_low_3 (Length: 422)
Name: NF8826_low_3
Description: NF8826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8826_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 16 - 412
Target Start/End: Complemental strand, 26449645 - 26449249
Alignment:
| Q |
16 |
tggacatccctcagaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttctttgcctgcata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
26449645 |
tggacatccctcagaatttacatcatcttctgcaatctaatgtggatacctacatcaaagattcaaattggaatgttcctcaagcttttttggttgcata |
26449546 |
T |
 |
| Q |
116 |
tcctgctttgcagcagaaactattgttgactactatacctattttccctaaagaagataaactaatatagaaagcctctcatgatggaaatctagctttt |
215 |
Q |
| |
|
| |||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
26449545 |
ttctgctttggagcaaaaactattgatgactactatacctattgtccctaaagaagataaactaatatggaaagcctctcatgatggaaatttagctttt |
26449446 |
T |
 |
| Q |
216 |
aaagacgcatatctcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccgtgcttg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26449445 |
aaagacgcatatctcttcctgacttccaatcagcctcagaacatcagttgggccaaagtcatttggcacattgctatccctccttctaagtccttgcttg |
26449346 |
T |
 |
| Q |
316 |
tttggagactgttgcataacaagcttcctacagatgataacctctctcttagaggctttcatactacatccatttgcaatctctgtggtcctgctca |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
26449345 |
tttggagactgttgcataacaagcttcctacagatgataacctctctcttagaggctgtcatactacatccatttgcaatctctgtagtgctgctca |
26449249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University