View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8828_low_6 (Length: 305)
Name: NF8828_low_6
Description: NF8828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8828_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 116 - 266
Target Start/End: Complemental strand, 50559452 - 50559302
Alignment:
| Q |
116 |
cttgaaataactttgttcatttaattaatgataatagtacgaatacaagtgagtacattagtgaaactgtggagactaacataagatgtgtcgtcgtagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||| ||| |
|
|
| T |
50559452 |
cttgaaataactttgttcatttaattaatgataatagtacgaatacaagtgggtacattagtgaaaatgtggagactaacataagatgtctcgtcgcagt |
50559353 |
T |
|
| Q |
216 |
tataaagtgagcaactttgttgatttgcctcatagtaaaatcaacataaaa |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50559352 |
tataaagtgagcaactttgttgatttgcctcatagtaaattcaacataaaa |
50559302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University