View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8828_low_7 (Length: 283)
Name: NF8828_low_7
Description: NF8828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8828_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 6815790 - 6816069
Alignment:
| Q |
1 |
gaataaagtggtgtcttttaaagtgtctcttttagtatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggagttcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6815790 |
gaataaagtggtgtcttttaaagtgtctcttttaatatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggagttcttcaa |
6815889 |
T |
 |
| Q |
101 |
ccaagatcgttgttatgctcgggtgattgtgggatggtagaatgtggtgaatcatgtcttcttggatttcgannnnnnngggaagtagtttggtccttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6815890 |
ccaagatcgttgttatgctcgggtgattgtgggatggtagaatatggtgaatcatgtcttcttggatttcgatttttttgggaagtagtttggtccttcg |
6815989 |
T |
 |
| Q |
201 |
ttttaaagtggttaggtatatctagcgtgcttttatctgatattggtttgcaatctactcagttggatgatgtccatctc |
280 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
6815990 |
ttttgaagtggttagggatatctagcgtgctttcatctgatattggtttgcaatcttctcagttggatggtgtccatctc |
6816069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University