View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8829_low_3 (Length: 306)
Name: NF8829_low_3
Description: NF8829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8829_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 43586822 - 43586641
Alignment:
| Q |
15 |
ttatgattaggaggcattgatttggtccttttcatccaagatggaggtgcagatgacgaaaatgaccttgaacgatgaaaacgacacctgaaagagcctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43586822 |
ttatgattaggaggcattgatttggtccttttcatccaaggtggaggtgcagatgacgaaaatgaccctgaacgatgaaaacgacacctgaaagagcctt |
43586723 |
T |
 |
| Q |
115 |
cgtgtgtcgttggtgaacatagacaccgtcctttgggaaacgacgccgctgcatcatcaccgattccactgtcacttttggg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43586722 |
cgtgtgtcgttggtgaacatagacaccgtcctttgggaaacgacgccgctgcatcaccaccgattccactgtcacttttggg |
43586641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 290
Target Start/End: Complemental strand, 43586556 - 43586523
Alignment:
| Q |
257 |
ctgggaagccattaatcaaggaggtgaaagaggt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43586556 |
ctgggaagccattaatcaaggaggtgaaagaggt |
43586523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University