View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8829_low_4 (Length: 282)
Name: NF8829_low_4
Description: NF8829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8829_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 10605717 - 10605969
Alignment:
| Q |
18 |
cttgtgctatagtaactaagtcaatttccatggcagatctttgaattctaatagatttagtggaagaattccaccttctatcggtaatctgtcaaatatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10605717 |
cttgtgctatagtaactaagtcaatttccatggcagatctttgaattctaatagatttagtggaagaattccaccttctattggtaatctgtcaaatatt |
10605816 |
T |
|
| Q |
118 |
aattggctagacttagcagaaaaccagcttgagggtcccatcccagtatctaatggaactactcctggtcttgatatgcttcacaaaacaaagcacttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10605817 |
aattggctagacttagcagaaaaccagcttgagggtcccatcccagtatctaatggaactactcctggtcttgatatgcttcacaaaacaaagcacttgt |
10605916 |
T |
|
| Q |
218 |
atgtgatgttaacnnnnnnnnncttttgataatatttacagtaatttgcttcat |
271 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10605917 |
atgtgatgttaac-ttttttttcttttgataatatttacagtaatttgcttcat |
10605969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University