View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8829_low_6 (Length: 279)
Name: NF8829_low_6
Description: NF8829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8829_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 6 - 263
Target Start/End: Original strand, 39138895 - 39139152
Alignment:
| Q |
6 |
tgagatggacatcaacattctcatcaacatccgtgaactcttcttcagcatcaatctgaacgtttcagagattgagtggatatatatacattcgattgtt |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39138895 |
tgagatgttcatcaacattctcatcaacatccgtgaactcttcttcagcatcaatctgaacgtttcagagattgagtgaatatatatacattcgattgtt |
39138994 |
T |
 |
| Q |
106 |
ttacttgcatcttggtagaaggggagatgaattattttaccttattccaaacttcaatcatattctgaagcttctcttgtgacacgcctatttgttgaag |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39138995 |
ttacttgcattttggtagaaggggagatgaattattttaccttattccaaacttcaatcatattctgaagcttctcttgtgacacgcctatttgttgaag |
39139094 |
T |
 |
| Q |
206 |
aacttggaacaccgtcgtgcggtgctcttcaagattgggagcagtagaatccaccaca |
263 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139095 |
aacttggaacactgtcgtgcggtgctcttcaagattgggagcagtagaatccaccaca |
39139152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University