View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_high_11 (Length: 387)
Name: NF8830_high_11
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 20 - 382
Target Start/End: Original strand, 43625372 - 43625716
Alignment:
| Q |
20 |
gtgagttcttttatttttgttaatttgtttattgtttatgcaactttggttgagaattgaattgccacctttgtgtatttggaattatattcgcctttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43625372 |
gtgagttcttttatttttgttaatttgtttattgtttatgcaactttggttgagaattgaattgccacctttgtgtatttggaa---------------- |
43625455 |
T |
 |
| Q |
120 |
aaccgaattcgctttcatagttctcaatttgctttgtttgttttctcatttcttcagtgaggaatttgttaccagctatgatatgaaaaagtgtggaaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43625456 |
--ccgaattcgctttcatagttctcaatttgctttgtttgttttctcatttcttcagtgatgaatttgttaccagctatgatatgagaaagtgtggaaat |
43625553 |
T |
 |
| Q |
220 |
taatgaaatgttgtttttggtccttgcaggatacaagaaaaggacagcagcaaccatctaaggtatgtatgccctgtagcatttagcttttagaaggaaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43625554 |
taatgaaatgttgtttttggtccttgcaggattcaagaaaaggacagcagcaaccatctaaggtatgtatgccctgtagcatttagcttttagaaggaaa |
43625653 |
T |
 |
| Q |
320 |
aacattaatattttgtagagaatgttttgtaccaacgtatagattcaattgttctctgcttct |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43625654 |
aacatgaatattttgtagagaatgttttgtaccaacgtatagattcaattgttctatgcttct |
43625716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University