View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_high_22 (Length: 293)
Name: NF8830_high_22
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 4 - 149
Target Start/End: Original strand, 42540384 - 42540529
Alignment:
| Q |
4 |
gtttggtgttgtttacaaggttgagtagtttgcctcggaaacttcagcttgtttgttccggtcaagaaagtgcactgagaatgtgaattcttgttcaatc |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42540384 |
gtttggcgttgtttacaaggttgagtagtttgcctcggaaacttcagcttgtttgttccggtcaagaaagtgcactgagaatgtgaattcttgttcaatc |
42540483 |
T |
|
| Q |
104 |
ctcctcctctcgtcgcaaataaacccttggatcaatcagattcaga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42540484 |
ctcctcctctcgtcgcaaataaacccttggatcaatcagattcaga |
42540529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 42540594 - 42540658
Alignment:
| Q |
214 |
gtaattgtgagttactgtgacggtggatggtgagttgagagaattgcaggctgcggacattgttg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42540594 |
gtaattgtgagttactgtgacggtggatggtgaggtgagagaattgcaggctgcggacattgttg |
42540658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University