View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_18 (Length: 369)
Name: NF8830_low_18
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 39276234 - 39276383
Alignment:
| Q |
1 |
ataaatgttagttatactagttagatccaaaagtgtattcaatagtaggttgttagttgttactt------tccaccaccctataagtcttcaatatcgt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
39276234 |
ataaatgttagttatactagttagatccaaaagtgtattcaatagtaggttgttagttgttactactagtattttccaccctataagtcttcaatatcgt |
39276333 |
T |
|
| Q |
95 |
ttgaacggaggtaacacagttttgaatgatgaaactatcaaattttaatt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276334 |
ttgaacggaggtaacacagttttgaatgatgaaactatcaaattttaatt |
39276383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 235 - 352
Target Start/End: Original strand, 39276437 - 39276549
Alignment:
| Q |
235 |
atggcttgtgtgaaggaaccaactaaactaaactaatttgtgtaattaggacagaaacgcatctcattcgttattatgatgtgtcaaaccatggaggatt |
334 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39276437 |
atggcttgtgtgaaggaaccaact-----aaactaatttgtgtaattaggacagaaacgcatctgattcgttattatgatgtgtcaaaccatggaggatt |
39276531 |
T |
|
| Q |
335 |
cccatcgaaccatattct |
352 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
39276532 |
cccatggaaccatattct |
39276549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University