View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_26 (Length: 315)
Name: NF8830_low_26
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 21 - 311
Target Start/End: Original strand, 26106734 - 26107026
Alignment:
| Q |
21 |
tatttattttcaatcgaaatatcatattaattaagact--ttcttttgaggaattggagggttaaaaccatagtatgattatatgaaatgaaatggcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26106734 |
tatttattttcaatcgaaatatcatattaattaagactctttcttttgaggaattggagggttaaaaccatagtatgattatatgaaatgaaatggcaaa |
26106833 |
T |
 |
| Q |
119 |
agttgaaaagaatgtttcatgtcatcaaacagattttgataaagaaattacaaagtactttgtgaacaatattgcacaagaaatcacaaagtaatagctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26106834 |
agttgaaaagaatgtttcatgtcatctgacagattttgataaagaaattacaaagtactttgtgaacaatattgcacaagaaatcacaaagtaatagctt |
26106933 |
T |
 |
| Q |
219 |
acaatacacagatgccagcaaatagtagatacaatgtcaattacaatttcttttttggactaagtttacaattttaatgttttcatctcactc |
311 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
26106934 |
acaatacacagatgccagcaaataatagatacaatgtcaattacaatttcttttttggactaagtttacaattttaatgttgtcatcacactc |
26107026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University