View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_27 (Length: 310)
Name: NF8830_low_27
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 108 - 218
Target Start/End: Complemental strand, 2694518 - 2694408
Alignment:
| Q |
108 |
aatttcactttgtacaactgttataaataagtagaaacaattgtacatactggatttgtacaagtccatagataaatcaaacatatggacatagattcca |
207 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2694518 |
aatttcactttgtacaactgttattaaaaagtagaaacaattgtacatactggatttgtacaagtccatagataaattaaacatatggacatagattcct |
2694419 |
T |
|
| Q |
208 |
gatattattta |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
2694418 |
gatattattta |
2694408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 35 - 179
Target Start/End: Complemental strand, 655966 - 655816
Alignment:
| Q |
35 |
atatcataaatattgccatgattttcaaggtaacaaatatagtaaaaaccatta-----attgtaatgaacatata-taaatttcactttgtacaactgt |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| ||||| |||||| |||||||| ||| || | ||||||||||||| ||||||||| |
|
|
| T |
655966 |
atatcataaatattgcaatgattttcaaggtaacgaatatggtaaa--ccattactctaattgtaattaacgtaaaataaatttcactttctacaactgt |
655869 |
T |
|
| Q |
129 |
tataaataa--gtagaaacaattgtacatactggatttgtacaagtccataga |
179 |
Q |
| |
|
|||||| || ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
655868 |
tataaaaaaaagtagaaacaattgtaagaactggatttgtacaagtccataga |
655816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University