View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_45 (Length: 243)
Name: NF8830_low_45
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38259158 - 38258926
Alignment:
| Q |
1 |
ttgccattttagctaaaactggatttgcttttaaagaatgctcgtatgcaatccaattgtgttcagacacatattttagtatctcataaagtgtccaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38259158 |
ttgccattttagctaaaactggatttgcttttagagaatgctcgtatgcaattcaattgtgttcaggcacatattttagtatctcataaagtgtccaacc |
38259059 |
T |
 |
| Q |
101 |
ctgcattacaagaccctattcagttttcaccttcttccatacatatacatgacataaaatacactagattcatttcaaccattttctccatccgtctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38259058 |
ctgcattacaagaccctattcagttttcaccttcttccatacatatacgtgacataaaatacactagattcatttcaaccattttctccatccgtctttt |
38258959 |
T |
 |
| Q |
201 |
tgtgtggttgtttgttttcctttttgtgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38258958 |
tgtgtggttgtttgttttcctttttgtgatgtc |
38258926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 38238998 - 38238814
Alignment:
| Q |
1 |
ttgccattttagctaaaactggatttgcttttaaagaatgctcgtatgcaatccaattgtgttcagacacatattttagtatctcataaagtgtccaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| ||||| || ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
38238998 |
ttgccattttagctaaaactggatttgctttcagagattgctcataggcaatccaattgtgttcaggcacatatttcagtatctcataaagtgtccaacc |
38238899 |
T |
 |
| Q |
101 |
ctgcattacaagaccctattcagttttcaccttcttccatacatatacatgacataaaatacactagattcatttcaaccattttctcc |
189 |
Q |
| |
|
||| |||| | |||||| |||||||||| |||||||||| |||| ||| ||||||||||||||||| ||||||||| |||||| |
|
|
| T |
38238898 |
ctgaattatgaaaccctaatcagttttcaacttcttccatt----tacaatacagaaaatacactagattcaattcaaccatcttctcc |
38238814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University