View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_46 (Length: 242)
Name: NF8830_low_46
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 30697681 - 30697893
Alignment:
| Q |
20 |
cactaaaaaccctatatgatttcttatcatcacaacccaaacttgaa-ttttgtttgtactcaaactaatatacttgtaattcaatagaaaagtaacgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
30697681 |
cactaaaaaccctatatgatttcttatcatcacaacccaaacttgaacttttgtttatactcaaactaatatacttgtaattcaatagaaaaataacaaa |
30697780 |
T |
|
| Q |
119 |
tttccctgaatgataaattatgaaaagtctttaactaacccgacaatggaacaactaacatttgatgcattcttttgctcaaaagattatagttctctag |
218 |
Q |
| |
|
| | ||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30697781 |
tcttccttaatgataaattatgaaaagtctttaactaacccagctatggaacaactaacatttgatgcattctttttctcaaaagattatagttctctag |
30697880 |
T |
|
| Q |
219 |
acttcatctcact |
231 |
Q |
| |
|
|||| || ||||| |
|
|
| T |
30697881 |
actttatgtcact |
30697893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University