View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_47 (Length: 242)
Name: NF8830_low_47
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 94 - 227
Target Start/End: Complemental strand, 10300203 - 10300070
Alignment:
| Q |
94 |
aacttggattacatagatattagttagagctttgagtcttcattttgaagcttaactataatttggttttgtcataaaaagatgacagtggaaaaaggta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300203 |
aacttggattacatagatattagttagagttttgagtcttcattttgaagcttaactataatttggttttgtcataaaaagatgacagtggaaaaaggta |
10300104 |
T |
 |
| Q |
194 |
gcaacatgaaccatcaacaacagccatttgaagt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10300103 |
gcaacatgaaccatcaacaacagccatttgaagt |
10300070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 10300252 - 10300187
Alignment:
| Q |
12 |
agttatatacttatatgtgctttgcttgtgttacaaatttgagtacatcaacttggattacataga |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300252 |
agttatatacttatatgtgctttgcttgtgttacaaatttgagtacatcaacttggattacataga |
10300187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University