View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_48 (Length: 241)
Name: NF8830_low_48
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 12831469 - 12831289
Alignment:
| Q |
19 |
acttgtgggaagaaatgcaatggcaccactagttcagctgttctttcgcaacttggggatagtaatcaatatgtgaaaaatatgtgtgcaattacagtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12831469 |
acttgtgggaagaaatgcaatggcaccactagttcagctgttctttcgcaacttggggatagtaatcaatatgtgaaaaatatgtgtgcaattacagtct |
12831370 |
T |
|
| Q |
119 |
ccattgctaaccaattttctcaatcaaatcgtcaaactttaacataaattttttaggggtcatgctaacatgtgcaagggc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12831369 |
ccattgctaaccaattttctcaatcaaatcgtcaaactttaacataaattttttaggggtcatgctaacatgtgcaggggc |
12831289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 174
Target Start/End: Complemental strand, 12838296 - 12838141
Alignment:
| Q |
19 |
acttgtgggaagaaatgcaatggcaccactagttcagctgttctttcgcaacttggggatagtaatcaatatgtgaaaaatatgtgtgcaattacagtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12838296 |
acttgtgggaagaaatgcaatggcaccactagttcagctgttctttcgcaacttggggatagtaatcaatatgtgaaaaatatgtgtgcaattacagtct |
12838197 |
T |
|
| Q |
119 |
ccattgctaaccaattttctcaatcaaatcgtcaaactttaacataaattttttag |
174 |
Q |
| |
|
||||||||| ||||||| ||||||||| || |||| |||| |||||||||||||| |
|
|
| T |
12838196 |
ccattgctacccaatttcctcaatcaactcaccaaattttaccataaattttttag |
12838141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 62 - 124
Target Start/End: Complemental strand, 12812371 - 12812309
Alignment:
| Q |
62 |
tttcgcaacttggggatagtaatcaatatgtgaaaaatatgtgtgcaattacagtctccattg |
124 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812371 |
tttcgccacttggagatagtaatcaatatgtgaaaaatatgtgtgcaattacagtctccattg |
12812309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 12831264 - 12831228
Alignment:
| Q |
205 |
ttaagtatttattcagaaaaaatattttttgaaattt |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12831264 |
ttaagtatttattgagaaaaaatattttttgaaattt |
12831228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University