View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_49 (Length: 239)
Name: NF8830_low_49
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 38259258 - 38259473
Alignment:
| Q |
8 |
atcaactcttataagttatatccgaaatacaactttacgaggctattcaaatttgatcttgttggatttactctccatggatctcttcctcgctattact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38259258 |
atcaactcttataagttatatccgaaatacaactttacgaggctattcaaatttggtcttgttggatttgctctccatggatctcttcctcgctattact |
38259357 |
T |
 |
| Q |
108 |
accaactttgcgaggaaattaatgtatataattggtttggaactattaggttattttctatcaatggctaaaactgttttgcattttttcatattggctc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38259358 |
accaactttgcgaggtaattaatgtatataattggtttggaactattaggttattttctatcaatggctaaaactgttttgcattttttcatattggctc |
38259457 |
T |
 |
| Q |
208 |
tttctcctttccaaca |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38259458 |
tttctcctttccaaca |
38259473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 64 - 114
Target Start/End: Original strand, 38239186 - 38239236
Alignment:
| Q |
64 |
tcttgttggatttactctccatggatctcttcctcgctattactaccaact |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
38239186 |
tcttgttgggtttactctccatggatctctttctcactattactaccaact |
38239236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University