View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_50 (Length: 238)
Name: NF8830_low_50
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 19232417 - 19232626
Alignment:
| Q |
13 |
agagaggtgaagctgtgggaggttaaggatgtattaagttcgggaatgaaagaaatcggttcgatgccgaaggaaatggtggagaagttgaagggtgatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
19232417 |
agagaggtgaagctgtgggaggttaaggatggattaagttcgggaatgaaagaaatcggttcgatgccgaaggagatggtggagaagctgaagggtgatt |
19232516 |
T |
 |
| Q |
113 |
cagagtttggttcagttgaagtgatttgggttggtgattttgtttacttgcggaacacgttagtattagaggagcttgttgtatgtgaggttatgaatgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19232517 |
cagagtttggttcagttgaagtgatttgggttggggattttgtttacttgcggaacacgttagtactagaggagcttgttgtatgtgaggttatgaatgg |
19232616 |
T |
 |
| Q |
213 |
aagtttgtgt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
19232617 |
aagtttgtgt |
19232626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 50 - 211
Target Start/End: Original strand, 14619858 - 14620019
Alignment:
| Q |
50 |
gttcgggaatgaaagaaatcggttcgatgccgaaggaaatggtggagaagttgaagggtgattcagagtttggttcagttgaagtgatttgggttggtga |
149 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||| | |
|
|
| T |
14619858 |
gttcgggaatggaggaaataggttcgatgccgaaggagatggtggagaagttgaagggtgattctgagtttggttcaattgaagcaatttgggttgggaa |
14619957 |
T |
 |
| Q |
150 |
ttttgtttacttgcggaacacgttagtattagaggagcttgttgtatgtgaggttatgaatg |
211 |
Q |
| |
|
||| ||||||||||| |||||||| || ||||| || |||||||||||||||||| |||||| |
|
|
| T |
14619958 |
tttggtttacttgcgtaacacgttggtgttagatgaacttgttgtatgtgaggttgtgaatg |
14620019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 13 - 204
Target Start/End: Complemental strand, 14629579 - 14629388
Alignment:
| Q |
13 |
agagaggtgaagctgtgggaggttaaggatgtattaagttcgggaatgaaagaaatcggttcgatgccgaaggaaatggtggagaagttgaagggtgatt |
112 |
Q |
| |
|
||||| || |||||||||| |||||||| | | || |||||||||| | ||||| ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14629579 |
agagaagtaaagctgtgggctgttaaggaggaaatagattcgggaatggaggaaataggttcgatgccgaaggagatggtggagaagttgagaggtgatt |
14629480 |
T |
 |
| Q |
113 |
cagagtttggttcagttgaagtgatttgggttggtgattttgtttacttgcggaacacgttagtattagaggagcttgttgtatgtgaggtt |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| ||||||||||| |||||||| || || || || |||||||||||||||||| |
|
|
| T |
14629479 |
cagagtttggttcagttgaagcaatttgggttgggaatttggtttacttgcgtaacacgttggtgttggatgaacttgttgtatgtgaggtt |
14629388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University