View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_51 (Length: 234)
Name: NF8830_low_51
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 12831085 - 12830859
Alignment:
| Q |
1 |
ttttagatttgtctcattgtgtatatatag-tattg-attgatatatataccttttagtgggataaggattgattgtaaatgtgatgtcgattattgtcc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
12831085 |
ttttagatttgtctcattgtgtatatatatatatagtattgatatatataccttttagtgggataaagattggttgtaaatgtgatgtcgattattgtcc |
12830986 |
T |
|
| Q |
99 |
ataatttgtacattataaacaaatgggcagtaaaaagctacgagcttgttgtataatagtttttgtagctaagcaattgtaaatgcaatatatagagtgt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12830985 |
ataatttgtacattataaacaaatgggcagtaaaaagctacgagcttgttgtataatagtttttgtagctaagcaattgtaaatgcaatatatagagtgt |
12830886 |
T |
|
| Q |
199 |
attattatcatataatgatgtgaagta |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
12830885 |
attattatcatataatgatgtgaagta |
12830859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 92 - 211
Target Start/End: Complemental strand, 12812170 - 12812050
Alignment:
| Q |
92 |
attgtccataatttgtacattataaacaaatgggcagtaaaaagctacgagcttgttgtat--aatagtttttgtagctaagcaattgtaaatgcaatat |
189 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||| ||||||| ||||||||||||| |||||| ||| |||||| ||||||||||||||||| | |
|
|
| T |
12812170 |
attgtccataatttgcaaattataaacaaatggcaagtgaaaagctgtgagcttgttgtattcaatagtcttt-tagctaggcaattgtaaatgcaattt |
12812072 |
T |
|
| Q |
190 |
atagagtgtattattatcatat |
211 |
Q |
| |
|
||| ||| |||||||||||| |
|
|
| T |
12812071 |
ataaagttagttattatcatat |
12812050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University