View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8830_low_52 (Length: 229)
Name: NF8830_low_52
Description: NF8830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8830_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 26107266 - 26107089
Alignment:
| Q |
1 |
tcaaacaacgctgcacaaaaatgacaaacaaaataaagttgcactcagaggga-tcaacggagtttgaacctgaaatgcgaaatctcttaatctaatatt |
99 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
26107266 |
tcaaataacgctgcacaaaaatgacaaataaaataaagttgcactcagagagaatcaacggagtttgaacctgaaatgtgaaatctcttgatctaatatt |
26107167 |
T |
 |
| Q |
100 |
tgttttatatactaccagcagagtaacttgatctaatctttgattaataatactaaatgcattagaagacagaaaaccaaaa |
181 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26107166 |
tgttttatatactaccagcggagtaacttgatctaatctttgatt----atactaaatgcattagaagacagaaaaccaaaa |
26107089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University