View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8831_low_10 (Length: 333)
Name: NF8831_low_10
Description: NF8831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8831_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 9166069 - 9165868
Alignment:
| Q |
18 |
aataggacaatctgagaacacattgtttaaaagttgtctaacacaaaaatctgttaaaagtgaaagaccgataagctcgcaagacttgagtagagcttgg |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166069 |
aataggacaatctgagaacatattgtttaaaagttatctaacacaaaaatctgttaaaagtgaaagaccgataagctcgcaagacttgagtagagcttgg |
9165970 |
T |
 |
| Q |
118 |
ataaggataacccgtgagttatagcatctaagtacaatgtgctgattttgtag-acaactaattagcttgactataccgttgattctctctttctctctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9165969 |
ataaggataacccgtgagttatagcatctaagtacaatgtgctgatttcgtagcacaactaattagcttgactataccgttgattctctctctctctctc |
9165870 |
T |
 |
| Q |
217 |
tc |
218 |
Q |
| |
|
|| |
|
|
| T |
9165869 |
tc |
9165868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 260 - 322
Target Start/End: Complemental strand, 9165816 - 9165754
Alignment:
| Q |
260 |
ttaactcggtataaattgaaaactttcaaatcagattttgtatttattctttctgtaagtata |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9165816 |
ttaactcggtataaattgaaaactttcaaatcagagtttgtatttattctttctgtaagtata |
9165754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University