View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8831_low_20 (Length: 255)
Name: NF8831_low_20
Description: NF8831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8831_low_20 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 27779995 - 27780235
Alignment:
| Q |
13 |
attattcttaaagcaaccactaattattaattaatcctaagaactccgatttattgtatacaatnnnnnnngttgacccaatattcttcaccccatatgt |
112 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| ||| |||||||| |||| ||| |||| ||||||| |||||||||||| |
|
|
| T |
27779995 |
attattctttaaacaaccactaattattaattaatcctaagaactcagatatattgtat-caatacaaaaagttcaccctatattctccaccccatatgt |
27780093 |
T |
 |
| Q |
113 |
tagtacatattcttttccccaaaatattttattcatctttaaccctttattccctttcc--nnnnnnnnnnnnnnaacttcttttgtactttcatatctc |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27780094 |
tagtacatattcttttccccaaaatatattattcatctttaaccctttattccctttccttttttttttttttttaacttcttttgtactttcatatc-- |
27780191 |
T |
 |
| Q |
211 |
atcatgcagtcaggttgttgcaaaccaccaacaaaatgtggttac |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27780192 |
-tcatgcagtcaggttgttgcaaaccaccaacaaaatgtggttac |
27780235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University