View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8831_low_7 (Length: 360)
Name: NF8831_low_7
Description: NF8831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8831_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 2 - 318
Target Start/End: Original strand, 31465410 - 31465726
Alignment:
| Q |
2 |
cagaaatcccaacccaatatcagattatttcatagatttggatataatctcaaaatttgagttttaggtgtaactcaaccctaaaatgtagctccccagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465410 |
cagaaatcccaacccaatatcagattatttcatagatttggatataatctcaaaatttgagttttaggtgtaactcaaccctaaaatgtagctccccagg |
31465509 |
T |
|
| Q |
102 |
tgggggttacccaaacattagaaggactaatttagcttttattagatgtgggatctcaatagttactttttgtctacatgcaattcggcctctattgtac |
201 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465510 |
tgggggttgcccaaacattagaaggattaatttagcttttattagatgtgggatctcaatagttactttttgtctacatgcaattcggcctctattgtac |
31465609 |
T |
|
| Q |
202 |
agttgagacagtgatttaatcaaaagtctccactctcctgttttctctttctttaataccctgtgttgtatttgagacatgtatttcatcaaatatgttt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31465610 |
agttgagacagtgatttaatcaaaagtctccgctctcctgttttctctttctttaataccctgtgttgtatttgagacatgtatttcatcaaatatgttt |
31465709 |
T |
|
| Q |
302 |
tctcttccttttatatg |
318 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31465710 |
tctcttccttttatatg |
31465726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 31452317 - 31452398
Alignment:
| Q |
13 |
acccaatatcagattatttcatagatttggatataatctcaaaatttgagttttaggtgtaactcaaccctaaaatgtagctc |
95 |
Q |
| |
|
||||||||||||||| | | |||||||||| | |||||| ||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31452317 |
acccaatatcagatt-tataatagatttggttttaatcttaaaatttgagttttaggcctaactcaaccctaaaatctagctc |
31452398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University