View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8832_high_1 (Length: 603)

Name: NF8832_high_1
Description: NF8832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8832_high_1
NF8832_high_1
[»] chr7 (1 HSPs)
chr7 (490-585)||(2353798-2353893)
[»] chr4 (1 HSPs)
chr4 (152-217)||(3569326-3569391)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 5e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 2353893 - 2353798
Alignment:
490 gtttatagacctctcaagtagtctaaaattcccttgctttatagcatcgggaggtatgagtcaaacctcttaggatttagtcttcgatgctatcaa 585  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
2353893 gtttatagacctctcaagtagtctaaatttcccttgctttatagcatctggaggtatgagtcaaacctcttaggatttagtcttcgatgctatcaa 2353798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 3569391 - 3569326
Alignment:
152 ttcagcttataaaatttgaattacttttttgtttggatgttataatccgaattgatgaaaaactca 217  Q
    ||||| |||||||||  ||  ||||| ||||||||||| ||||||||||||||| || ||||||||    
3569391 ttcagattataaaatccgagctacttatttgtttggattttataatccgaattggtggaaaactca 3569326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University