View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8832_low_2 (Length: 603)
Name: NF8832_low_2
Description: NF8832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8832_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 5e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 2353893 - 2353798
Alignment:
| Q |
490 |
gtttatagacctctcaagtagtctaaaattcccttgctttatagcatcgggaggtatgagtcaaacctcttaggatttagtcttcgatgctatcaa |
585 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2353893 |
gtttatagacctctcaagtagtctaaatttcccttgctttatagcatctggaggtatgagtcaaacctcttaggatttagtcttcgatgctatcaa |
2353798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 3569391 - 3569326
Alignment:
| Q |
152 |
ttcagcttataaaatttgaattacttttttgtttggatgttataatccgaattgatgaaaaactca |
217 |
Q |
| |
|
||||| ||||||||| || ||||| ||||||||||| ||||||||||||||| || |||||||| |
|
|
| T |
3569391 |
ttcagattataaaatccgagctacttatttgtttggattttataatccgaattggtggaaaactca |
3569326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University