View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8832_low_5 (Length: 207)

Name: NF8832_low_5
Description: NF8832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8832_low_5
NF8832_low_5
[»] chr8 (2 HSPs)
chr8 (112-194)||(17933209-17933291)
chr8 (20-58)||(17933309-17933347)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 17933291 - 17933209
Alignment:
112 ttacacttctataatgcttttatcaacccatccataacgccacttagatccctatctaatagaattttcttcaaggagaataa 194  Q
    |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||    
17933291 ttacacatctataatgcttttatcaacccatccacaacgccacttagatccctatctaatagcattttcttcaaggagaataa 17933209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 17933347 - 17933309
Alignment:
20 agaaactaaagaaaatcgttgtagtgctaatagaattaa 58  Q
    |||||||||||||||||||||||||||||||||||||||    
17933347 agaaactaaagaaaatcgttgtagtgctaatagaattaa 17933309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University