View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8832_low_5 (Length: 207)
Name: NF8832_low_5
Description: NF8832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8832_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 17933291 - 17933209
Alignment:
| Q |
112 |
ttacacttctataatgcttttatcaacccatccataacgccacttagatccctatctaatagaattttcttcaaggagaataa |
194 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17933291 |
ttacacatctataatgcttttatcaacccatccacaacgccacttagatccctatctaatagcattttcttcaaggagaataa |
17933209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 17933347 - 17933309
Alignment:
| Q |
20 |
agaaactaaagaaaatcgttgtagtgctaatagaattaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17933347 |
agaaactaaagaaaatcgttgtagtgctaatagaattaa |
17933309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University