View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8834_high_2 (Length: 410)
Name: NF8834_high_2
Description: NF8834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8834_high_2 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 113 - 410
Target Start/End: Complemental strand, 2061782 - 2061485
Alignment:
| Q |
113 |
gagttaggttaccaaactaggggtggcacgaacaaccgcacaactccggcgagcaccagataattgacggaccacgaaacagtgcagaaactgacaccca |
212 |
Q |
| |
|
||||| ||| ||||||| ||||||||| |||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
2061782 |
gagttcggtcaccaaaccaggggtggcgtgaacaatcgcacaactccggcgagcaccagataactgacgaaccacgaaacagtggagaaagtgacaccca |
2061683 |
T |
 |
| Q |
213 |
agctcgttaacagctacccaaacggcgacggtggagctgtttgtcgacaaacgacgagaggtgacgggatctgaacaaagaagaccacgaaaatttatgt |
312 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2061682 |
agctcgttaacagccatccaaacggcgacggtggagctgtttgtcgacaaacgacgagaggtgacgggatctgaacaaagaagaccacgaaaatttatgt |
2061583 |
T |
 |
| Q |
313 |
cggaggaacgacgggaagacaagacagacgccggaggaaggaggttacgacggtggtgtaaagagcaacactcgacacaccaccctccctagatctac |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
2061582 |
cggaggaacgacgggaagacaagacagacgccggaggaaggaggttacgacggtggtgtaaagagcaacactcgacacaacaccctctctagatctac |
2061485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 2061894 - 2061832
Alignment:
| Q |
1 |
acgaacaacacaaaaaccaaccaaacctccggcatggtacaagcacccacgacactaccgtcg |
63 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2061894 |
acgaacaacacgaaaaccaaccaaacctccggcatggtacaagcacccacgacactaccgtcg |
2061832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University