View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8835_low_7 (Length: 283)
Name: NF8835_low_7
Description: NF8835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8835_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 44551512 - 44551242
Alignment:
| Q |
16 |
tattctcctatttatacacttaatttagttatata---ttttgaaactattttttcttttaattgttgagttttattgcaaccaatgcaaattgtacttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44551512 |
tattctcctatttatacacttaatttagttatatactattttgaaactattttttcttttaattgttgagttttactgcaaccaatgcaaattgtacttg |
44551413 |
T |
|
| Q |
113 |
actcaaaaaatgcaaattataatcttcatttccacgtgttaatttaatatccccatccaatgtccaaactcatattaaatggaatcatatgcaggtcata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44551412 |
actcaaaaaatgcaaattataatcttcatttccacgtgttaatttaatatccccatccaaggtccaaactcatattaaatggaatcatatgcaggtcata |
44551313 |
T |
|
| Q |
213 |
caattttcttttgaactttctagacgcatataatgattgggggtatccaattctcctctcatatattcttt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44551312 |
caattttcttttgaactttctagacgcatataatgattgggggtatccaattctcctctcatatattcttt |
44551242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University