View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8836_high_8 (Length: 229)
Name: NF8836_high_8
Description: NF8836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8836_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 35843914 - 35844129
Alignment:
| Q |
1 |
ttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgacgggtctagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35843914 |
ttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgactggtctagc |
35844013 |
T |
|
| Q |
101 |
aacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttgaccaccattttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35844014 |
aacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttg---accattttc |
35844110 |
T |
|
| Q |
201 |
tgacccacttggtctctgc |
219 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
35844111 |
cgacccaattggtctctgc |
35844129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University