View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8836_low_10 (Length: 240)

Name: NF8836_low_10
Description: NF8836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8836_low_10
NF8836_low_10
[»] chr6 (1 HSPs)
chr6 (111-194)||(33040656-33040739)
[»] chr4 (1 HSPs)
chr4 (49-112)||(11960754-11960817)
[»] chr1 (1 HSPs)
chr1 (49-113)||(50135026-50135090)


Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 111 - 194
Target Start/End: Original strand, 33040656 - 33040739
Alignment:
111 ttttattttcgatcaaacttatctcttcctcatgccaactcaaacaataatgtaaataggaaagtcatactgtgttaaagacta 194  Q
    ||||| |||| ||||||||||||||||||||||  ||| ||||||||||||||||||||||||| ||| || ||||||||||||    
33040656 ttttagtttccatcaaacttatctcttcctcatatcaattcaaacaataatgtaaataggaaagacatgctatgttaaagacta 33040739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 49 - 112
Target Start/End: Original strand, 11960754 - 11960817
Alignment:
49 aaactaaagggggtgtgagtgtcattaagtaaaacctcaaggaaggtaaatgcaattttctctt 112  Q
    |||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||    
11960754 aaactagagggggtgtgagtgtcattaagtaaaacctcaagggaggtaaatgtaattttctctt 11960817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 50135090 - 50135026
Alignment:
49 aaactaaagggggtgtgagtgtcattaagtaaaacctcaaggaaggtaaatgcaattttctcttt 113  Q
    |||||| |||||||||||||||| || |   ||||||||||| ||||||||| | ||||||||||    
50135090 aaactagagggggtgtgagtgtcttttaagcaaacctcaagggaggtaaatgtagttttctcttt 50135026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University