View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8836_low_11 (Length: 229)

Name: NF8836_low_11
Description: NF8836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8836_low_11
NF8836_low_11
[»] chr4 (1 HSPs)
chr4 (1-219)||(35843914-35844129)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 35843914 - 35844129
Alignment:
1 ttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgacgggtctagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
35843914 ttttccggcgacctttctccggcagcgttgttctgtcccttgcaactggagctcgactcgtttttcttgcagattgactccgacccacgactggtctagc 35844013  T
101 aacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttgaccaccattttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||    
35844014 aacgctggtgtcggtacacgtcgccggtgaccgggaccgtcggaaagaattctcgccggaatctctccggcgacgcattccctcgttg---accattttc 35844110  T
201 tgacccacttggtctctgc 219  Q
     |||||| |||||||||||    
35844111 cgacccaattggtctctgc 35844129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University