View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8837_high_5 (Length: 235)
Name: NF8837_high_5
Description: NF8837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8837_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43471075 - 43470851
Alignment:
| Q |
1 |
ataataccgttgacagaagtatcggatggcgtactagcagataaggtatgttgtggttgtgtaggtgtgaggggtgcaacacttgaagccgatgttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43471075 |
ataataccgttgacagaagtatcggatggcttactagcagataaaggatgttgtggttgtgtaggtgtgaggggtgcaacacttgaagccgatgttgtaa |
43470976 |
T |
|
| Q |
101 |
ttgcaacaggactagttcctctaactggcagctgagaggacgttacttgtggttgttgcagaggtccactactacccatgttgccatacccagggaaggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43470975 |
ttgcaacaggactagttcctctaactggcagctgagaggacgttacttgtggttgttgcagaggtccactactacccatgttgccatacccagggaaggc |
43470876 |
T |
|
| Q |
201 |
ggaggaagttgcagggtgatgtcca |
225 |
Q |
| |
|
|||||||||||||||| || ||||| |
|
|
| T |
43470875 |
ggaggaagttgcagggcgaggtcca |
43470851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 225
Target Start/End: Complemental strand, 5334951 - 5334903
Alignment:
| Q |
177 |
catgttgccatacccagggaaggcggaggaagttgcagggtgatgtcca |
225 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
5334951 |
catgttgccataagcagggaaggcagaggaagttgcagggtgaggtcca |
5334903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University