View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8837_low_12 (Length: 229)
Name: NF8837_low_12
Description: NF8837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8837_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 43471115 - 43471343
Alignment:
| Q |
1 |
cacctcatctcagcccaaccaaaactcttcttcacaaggattttcatctgccattgttcctgtatctggagggaaccagagttctattaggaccaccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43471115 |
cacctcatctcagcccaaccaaaactcttcttcacaaggattttcatctgccattgttcctgtatctggagggaaccagagttctattaggaccaccacc |
43471214 |
T |
|
| Q |
101 |
cctgattctttgcagacctcacttgctactcactctgttcgtccacatcttcttcagctgaaccagccggcagtgaatcagaaccagcatgcctcggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43471215 |
cctgattctttgcagacctcacttgctactcactctgttcgtccacatcttcttcagctgaaccagccggcagtgaatcagaaccagcatgcctcggttc |
43471314 |
T |
|
| Q |
201 |
aggcgcctaatatccccacttcatctgga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43471315 |
aggcgcctaatatccccacttcatctgga |
43471343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 94 - 152
Target Start/End: Original strand, 5335233 - 5335291
Alignment:
| Q |
94 |
caccacccctgattctttgcagacctcacttgctactcactctgttcgtccacatcttc |
152 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
5335233 |
caccacctctgattctttgcagagctcacttgctactcactctgttcgtccatatcttc |
5335291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 5335158 - 5335224
Alignment:
| Q |
1 |
cacctcatctcagcccaaccaaaactcttcttcacaaggattttcatctgccattgttcctgtatct |
67 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
5335158 |
cacctcatctcagcccaaccaagattcttctccacatggattttcatctgccattcttcatgtatct |
5335224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University