View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8837_low_4 (Length: 281)
Name: NF8837_low_4
Description: NF8837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8837_low_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 40572643 - 40572913
Alignment:
| Q |
17 |
ctgacacgttaatactccgaagatcaagtttagtatgaaaaacaaggtaagtatatacgaaagtgtaggaaaatgaatcatatcatgaaggataaccatc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||| |||||| || ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
40572643 |
ctgacacgttaatattccgaagatcaagtttagtataaaaaacaagggaagtatgtatgaaagtgtaggaagatgaatcatatcatgagggataaccatc |
40572742 |
T |
|
| Q |
117 |
tccgtgttatccagatccgccccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcaggtaagttggtggatgtttttatccac |
216 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
40572743 |
tccgtgttatccaaatccgctccaaggcatgttctagtggagcaagacgtattgttgttgacgtggtctttcagataagtcagtggatgttttcatccac |
40572842 |
T |
|
| Q |
217 |
gtatcactgtaaaattgaccttttgatcggtccggaacaa------tctttcttttattacataaatttag |
281 |
Q |
| |
|
|| ||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40572843 |
gtgtcactgtgaaattgaccttttgattggtccggaacaaattcagtctttcttttattacataaatttag |
40572913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University