View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8837_low_6 (Length: 251)
Name: NF8837_low_6
Description: NF8837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8837_low_6 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 25764509 - 25764271
Alignment:
| Q |
12 |
attatacttttaagctaaatccacttctactctgaaccatattggtgctctcattagtggcggctatgttatttttatcattttcttattagtcttctga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25764509 |
attatacttttaagctaaatccacttctactctgaaccatattggtgctctcattagtggcgtctatgttatttttcacattttcttattagtcttctga |
25764410 |
T |
|
| Q |
112 |
cttgtatttgttctctttaattaatatagtataaagtgtcatattaattactaaaattgcactttcaaagtgtcaaccagttgaaattggttatgttata |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
25764409 |
cttgtatttgttctc-ttaattaatatagtataaagtgttatattaattactaaaattacactttcaaagtgtcatccaattgaaattggttatgttata |
25764311 |
T |
|
| Q |
212 |
gatgatgtcttgagacatcaattagccttttatgtcaaaa |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25764310 |
gatgatgtcttgacacatcaattagccttttatgtcaaaa |
25764271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 251
Target Start/End: Complemental strand, 25747829 - 25747752
Alignment:
| Q |
174 |
tttcaaagtgtcaacc-agttgaaattggttatgttatagatgatgtcttgagacatcaattagccttttatgtcaaaa |
251 |
Q |
| |
|
|||| ||||||||||| ||||| |||| |||||||||| |||||||||||| |||| |||| || ||||||||||||| |
|
|
| T |
25747829 |
tttcgaagtgtcaacctagttggaatttcttatgttata-atgatgtcttgacacataaattggcattttatgtcaaaa |
25747752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University