View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8839_low_11 (Length: 307)
Name: NF8839_low_11
Description: NF8839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8839_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 42336505 - 42336228
Alignment:
| Q |
18 |
gttttcaattttcaaaatgaatctcaacattgtgttctctcttgcattcatctgcattgttatcgccggtgtcggaggccagtcgccttcaccggcacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42336505 |
gttttcaattttcaaaatgaatctcaacattgtgttctctcttgcattcatctgcattgttatcgccggtgtcgtaggccagtcgccttcaccggcacca |
42336406 |
T |
|
| Q |
118 |
gcccctgctgggtcttctccagcttcatctcccacatcaccagccccatctcctaaccctaacgcgccttcaccggccccattttcatctccaacaccag |
217 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336405 |
gcccccgctggttcttctccagcttcatctcccacatcaccaaccccatctcctaaccctaatgcgccttcaccggccccattttcatctccaacaccag |
42336306 |
T |
|
| Q |
218 |
cccccgctagcacttcaccggccccatctccttccaaccctccctcacatgcaccttcaccatcgccactttcatctc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336305 |
cccccgctagcacttcaccggccccatctccttccaaccctccctcacatgcaccttcaccatcgccactttcatctc |
42336228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 19792346 - 19792394
Alignment:
| Q |
50 |
tgttctctcttgcattcatctgcattgttatcgccggtgtcggaggcca |
98 |
Q |
| |
|
|||||||| ||||| |||||||||||||| |||||| |||| ||||||| |
|
|
| T |
19792346 |
tgttctcttttgcactcatctgcattgttgtcgccgctgtcagaggcca |
19792394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University